Incidental Mutation 'R5601:Fbxw7'
ID439013
Institutional Source Beutler Lab
Gene Symbol Fbxw7
Ensembl Gene ENSMUSG00000028086
Gene NameF-box and WD-40 domain protein 7
SynonymsFbw7, 1110001A17Rik, AGO, Cdc4, Fbxw6, SEL-10, Fbxo30
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84815268-84979198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84976208 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 482 (D482G)
Ref Sequence ENSEMBL: ENSMUSP00000029727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029727] [ENSMUST00000107675] [ENSMUST00000107678] [ENSMUST00000107679] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000029727
AA Change: D482G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029727
Gene: ENSMUSG00000028086
AA Change: D482G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
FBOX 206 246 3.7e-8 SMART
WD40 291 329 3.14e-6 SMART
WD40 332 369 2.1e-7 SMART
WD40 372 409 7.55e-9 SMART
WD40 412 449 2.22e-6 SMART
WD40 452 489 1.07e-8 SMART
WD40 492 529 1.75e-4 SMART
WD40 532 572 2.32e-9 SMART
WD40 575 623 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107675
AA Change: D442G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103302
Gene: ENSMUSG00000028086
AA Change: D442G

DomainStartEndE-ValueType
low complexity region 99 106 N/A INTRINSIC
FBOX 166 206 3.7e-8 SMART
WD40 251 289 3.14e-6 SMART
WD40 292 329 2.1e-7 SMART
WD40 332 369 7.55e-9 SMART
WD40 372 409 2.22e-6 SMART
WD40 412 449 1.07e-8 SMART
WD40 452 489 1.75e-4 SMART
WD40 492 532 2.32e-9 SMART
WD40 535 583 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107678
AA Change: D563G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103305
Gene: ENSMUSG00000028086
AA Change: D563G

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107679
AA Change: D563G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103306
Gene: ENSMUSG00000028086
AA Change: D563G

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151410
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this locus disrupts embryonic and extraembryonic vasculature, resulting in death by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Fbxw7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Fbxw7 APN 3 84969309 intron probably benign
IGL01468:Fbxw7 APN 3 84972499 missense probably benign 0.21
IGL01946:Fbxw7 APN 3 84904062 missense possibly damaging 0.60
IGL02248:Fbxw7 APN 3 84903633 missense possibly damaging 0.94
IGL02630:Fbxw7 APN 3 84965279 missense probably damaging 1.00
IGL02957:Fbxw7 APN 3 84976237 missense probably benign 0.00
PIT4453001:Fbxw7 UTSW 3 84965314 missense
R0043:Fbxw7 UTSW 3 84972567 intron probably benign
R0312:Fbxw7 UTSW 3 84967569 intron probably benign
R0595:Fbxw7 UTSW 3 84977367 intron probably null
R1664:Fbxw7 UTSW 3 84969171 missense possibly damaging 0.45
R1709:Fbxw7 UTSW 3 84976352 missense probably damaging 1.00
R1782:Fbxw7 UTSW 3 84903819 missense probably benign
R1974:Fbxw7 UTSW 3 84954935 missense possibly damaging 0.53
R2081:Fbxw7 UTSW 3 84974513 missense probably damaging 1.00
R2843:Fbxw7 UTSW 3 84976220 missense probably damaging 1.00
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3733:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R4333:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4335:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4581:Fbxw7 UTSW 3 84967545 missense probably benign 0.41
R4776:Fbxw7 UTSW 3 84925689 missense possibly damaging 0.53
R4799:Fbxw7 UTSW 3 84903861 nonsense probably null
R4822:Fbxw7 UTSW 3 84967507 missense possibly damaging 0.94
R5512:Fbxw7 UTSW 3 84954909 missense probably damaging 0.99
R5679:Fbxw7 UTSW 3 84977487 missense probably damaging 1.00
R6026:Fbxw7 UTSW 3 84952641 critical splice donor site probably null
R6182:Fbxw7 UTSW 3 84815771 critical splice donor site probably null
R6219:Fbxw7 UTSW 3 84969213 missense probably damaging 0.99
R6305:Fbxw7 UTSW 3 84976323 missense probably damaging 1.00
R6473:Fbxw7 UTSW 3 84952380 intron probably benign
R6823:Fbxw7 UTSW 3 84958627 missense probably benign 0.33
R6922:Fbxw7 UTSW 3 84972416 intron probably null
R7163:Fbxw7 UTSW 3 84925585 intron probably benign
R7229:Fbxw7 UTSW 3 84977369 missense unknown
R7554:Fbxw7 UTSW 3 84976313 missense
R7677:Fbxw7 UTSW 3 84904066 missense
R7711:Fbxw7 UTSW 3 84925681 missense probably benign
R7713:Fbxw7 UTSW 3 84967565 critical splice donor site probably null
R7873:Fbxw7 UTSW 3 84925764 missense possibly damaging 0.53
R8319:Fbxw7 UTSW 3 84974552 missense
Predicted Primers PCR Primer
(F):5'- ATCTATAGACTTTCATGGCATGCAC -3'
(R):5'- TAACAGAGGGCCAGGACTTAC -3'

Sequencing Primer
(F):5'- GACTTTCATGGCATGCACATCAG -3'
(R):5'- CCTTGCAAAGTTTGTAAACACTGTCC -3'
Posted On2016-10-26