Incidental Mutation 'R5601:Cwh43'
ID439017
Institutional Source Beutler Lab
Gene Symbol Cwh43
Ensembl Gene ENSMUSG00000029154
Gene Namecell wall biogenesis 43 C-terminal homolog
SynonymsC130090K23Rik
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73406075-73453435 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 73417940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031040] [ENSMUST00000065543]
Predicted Effect probably null
Transcript: ENSMUST00000031040
SMART Domains Protein: ENSMUSP00000031040
Gene: ENSMUSG00000029154

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 351 368 N/A INTRINSIC
transmembrane domain 395 412 N/A INTRINSIC
Pfam:Exo_endo_phos 435 580 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065543
SMART Domains Protein: ENSMUSP00000069563
Gene: ENSMUSG00000029154

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
transmembrane domain 260 282 N/A INTRINSIC
transmembrane domain 309 326 N/A INTRINSIC
Pfam:Exo_endo_phos 345 494 4.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Cwh43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Cwh43 APN 5 73421489 missense possibly damaging 0.93
IGL02225:Cwh43 APN 5 73421567 missense probably damaging 1.00
R0115:Cwh43 UTSW 5 73418027 missense probably damaging 1.00
R0423:Cwh43 UTSW 5 73416742 missense probably benign 0.00
R0481:Cwh43 UTSW 5 73418027 missense probably damaging 1.00
R0786:Cwh43 UTSW 5 73408183 nonsense probably null
R1635:Cwh43 UTSW 5 73434310 missense probably damaging 1.00
R1729:Cwh43 UTSW 5 73408218 missense probably damaging 0.99
R1784:Cwh43 UTSW 5 73408218 missense probably damaging 0.99
R1927:Cwh43 UTSW 5 73453074 missense probably benign 0.27
R2070:Cwh43 UTSW 5 73421517 missense probably damaging 1.00
R2104:Cwh43 UTSW 5 73421530 missense possibly damaging 0.93
R2136:Cwh43 UTSW 5 73415054 missense probably benign 0.01
R2517:Cwh43 UTSW 5 73421543 missense probably benign 0.04
R2964:Cwh43 UTSW 5 73408336 splice site probably benign
R3713:Cwh43 UTSW 5 73438492 missense probably damaging 0.99
R4291:Cwh43 UTSW 5 73411932 missense probably benign 0.35
R4333:Cwh43 UTSW 5 73441379 missense probably damaging 0.99
R4869:Cwh43 UTSW 5 73428673 critical splice donor site probably null
R5071:Cwh43 UTSW 5 73423913 critical splice acceptor site probably null
R5309:Cwh43 UTSW 5 73416767 missense probably benign
R5451:Cwh43 UTSW 5 73431913 missense probably benign 0.14
R5471:Cwh43 UTSW 5 73408231 nonsense probably null
R5652:Cwh43 UTSW 5 73418141 missense probably damaging 0.99
R5820:Cwh43 UTSW 5 73428632 nonsense probably null
R5823:Cwh43 UTSW 5 73411870 missense probably benign 0.27
R6351:Cwh43 UTSW 5 73411905 missense possibly damaging 0.55
R7467:Cwh43 UTSW 5 73411968 missense probably damaging 0.99
R7583:Cwh43 UTSW 5 73434289 missense probably benign 0.00
R7788:Cwh43 UTSW 5 73415034 missense probably damaging 1.00
R8070:Cwh43 UTSW 5 73421463 missense possibly damaging 0.64
R8282:Cwh43 UTSW 5 73434229 missense probably damaging 0.97
Z1177:Cwh43 UTSW 5 73430470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGCTGTGATTTTGAGC -3'
(R):5'- TTAAACGCTGTGCACCAGG -3'

Sequencing Primer
(F):5'- CTGTGATTTTGAGCAGACCACAG -3'
(R):5'- CACCAGGCACAGAAAAATGTTTG -3'
Posted On2016-10-26