Mutagenetix > Incidental Mutations

Incidental Mutation 'R5601:Tcaf3'

439021

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

043153-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.049) question?

Stock #

R5601 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42587528 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 900 (N900S)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069023
AA Change: N900S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: N900S

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot12	G	A	13: 91,782,910	V426I	probably benign	Het
Asmt	T	C	X: 170,676,392	V212A	probably damaging	Het
Atn1	A	G	6: 124,743,228		probably null	Het
Auts2	G	T	5: 131,476,823		probably benign	Het
AW551984	C	T	9: 39,591,267	V672M	possibly damaging	Het
Ccdc13	G	A	9: 121,800,572	Q114*	probably null	Het
Ces2e	A	T	8: 104,929,494	I146F	probably benign	Het
Cfap44	A	G	16: 44,460,186	K1443E	probably damaging	Het
Cma2	T	A	14: 55,973,789	H179Q	possibly damaging	Het
Cpsf2	G	T	12: 101,985,355		probably null	Het
Cwh43	A	G	5: 73,417,940		probably null	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dram1	A	G	10: 88,324,767	S231P	probably damaging	Het
Fbxw7	A	G	3: 84,976,208	D482G	probably damaging	Het
Fstl1	T	C	16: 37,826,799	I177T	probably benign	Het
Fut9	T	C	4: 25,620,299	T172A	probably benign	Het
Gm10436	T	C	12: 88,176,047	D267G	probably damaging	Het
Gm5134	G	A	10: 75,985,952	V207M	probably damaging	Het
Hccs	G	A	X: 169,313,601	R203C	probably damaging	Het
Hmgxb3	A	T	18: 61,137,622	F877I	probably damaging	Het
Ide	A	G	19: 37,314,980	V272A	unknown	Het
Impact	C	T	18: 12,976,007	T65I	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Muc3	A	G	5: 137,138,015	S309P	probably damaging	Het
Myf6	A	C	10: 107,494,614	S31A	probably damaging	Het
Olfr733	C	A	14: 50,298,861	W149C	probably damaging	Het
Olfr881	C	G	9: 37,992,714	T74R	possibly damaging	Het
P4hb	T	A	11: 120,571,615	E88D	possibly damaging	Het
Pcdhb9	T	C	18: 37,402,206	C418R	probably damaging	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Prss58	A	T	6: 40,897,849	N19K	possibly damaging	Het
Ptprq	C	T	10: 107,608,430	A1438T	probably benign	Het
Rfx4	A	T	10: 84,798,578	T61S	probably damaging	Het
Sclt1	T	A	3: 41,730,919	N35Y	probably benign	Het
Sec24b	CTG	CTGGTG	3: 130,040,834		probably benign	Het
Serpinb12	T	C	1: 106,953,697	I188T	probably damaging	Het
Slc27a4	A	T	2: 29,805,660	Y69F	probably benign	Het
Slc3a1	T	C	17: 85,032,891	V247A	probably benign	Het
Slc4a2	C	T	5: 24,438,774	T854I	probably benign	Het
Stat5b	G	A	11: 100,783,175	T761M	probably damaging	Het
Stkld1	T	C	2: 26,952,705	L563P	probably damaging	Het
Tbc1d23	C	A	16: 57,198,309	C283F	probably benign	Het
Tkfc	T	C	19: 10,594,563	T370A	probably benign	Het
Tpr	T	C	1: 150,435,853	V1868A	possibly damaging	Het
Triobp	T	A	15: 78,973,633	W1145R	probably damaging	Het
Uhrf1bp1	C	A	17: 27,884,494	A392D	probably damaging	Het
Vmn2r82	T	G	10: 79,396,191	L675V	probably damaging	Het
Zfp423	T	C	8: 87,782,009	E444G	probably damaging	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GAAGGTCAAGATACAAATCTCACAG -3'
(R):5'- GTCTTTGCTGACTACCGAACC -3'

Sequencing Primer
(F):5'- GCAAAATTTGAAAGCTGCTGTG -3'
(R):5'- GACTACCGAACCCTCTCTGG -3'

Posted On

2016-10-26