Incidental Mutation 'R5601:Tcaf3'
ID 439021
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 043153-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R5601 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42564462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 900 (N900S)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023]
AlphaFold Q6QR59
Predicted Effect possibly damaging
Transcript: ENSMUST00000069023
AA Change: N900S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: N900S

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151898
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,931,029 (GRCm39) V426I probably benign Het
Asmt T C X: 169,110,127 (GRCm39) V212A probably damaging Het
Atn1 A G 6: 124,720,191 (GRCm39) probably null Het
Auts2 G T 5: 131,505,662 (GRCm39) probably benign Het
AW551984 C T 9: 39,502,563 (GRCm39) V672M possibly damaging Het
Bltp3a C A 17: 28,103,468 (GRCm39) A392D probably damaging Het
Ccdc13 G A 9: 121,629,638 (GRCm39) Q114* probably null Het
Ces2e A T 8: 105,656,126 (GRCm39) I146F probably benign Het
Cfap44 A G 16: 44,280,549 (GRCm39) K1443E probably damaging Het
Cma2 T A 14: 56,211,246 (GRCm39) H179Q possibly damaging Het
Cpsf2 G T 12: 101,951,614 (GRCm39) probably null Het
Cwh43 A G 5: 73,575,283 (GRCm39) probably null Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dram1 A G 10: 88,160,629 (GRCm39) S231P probably damaging Het
Fbxw7 A G 3: 84,883,515 (GRCm39) D482G probably damaging Het
Fstl1 T C 16: 37,647,161 (GRCm39) I177T probably benign Het
Fut9 T C 4: 25,620,299 (GRCm39) T172A probably benign Het
Gm5134 G A 10: 75,821,786 (GRCm39) V207M probably damaging Het
Hccs G A X: 168,096,597 (GRCm39) R203C probably damaging Het
Hmgxb3 A T 18: 61,270,694 (GRCm39) F877I probably damaging Het
Ide A G 19: 37,292,379 (GRCm39) V272A unknown Het
Impact C T 18: 13,109,064 (GRCm39) T65I probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Muc17 A G 5: 137,166,863 (GRCm39) S309P probably damaging Het
Myf6 A C 10: 107,330,475 (GRCm39) S31A probably damaging Het
Or4n4b C A 14: 50,536,318 (GRCm39) W149C probably damaging Het
Or8b35 C G 9: 37,904,010 (GRCm39) T74R possibly damaging Het
P4hb T A 11: 120,462,441 (GRCm39) E88D possibly damaging Het
Pcdhb9 T C 18: 37,535,259 (GRCm39) C418R probably damaging Het
Pramel51 T C 12: 88,142,817 (GRCm39) D267G probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Prss58 A T 6: 40,874,783 (GRCm39) N19K possibly damaging Het
Ptprq C T 10: 107,444,291 (GRCm39) A1438T probably benign Het
Rfx4 A T 10: 84,634,442 (GRCm39) T61S probably damaging Het
Sclt1 T A 3: 41,685,354 (GRCm39) N35Y probably benign Het
Sec24b CTG CTGGTG 3: 129,834,483 (GRCm39) probably benign Het
Serpinb12 T C 1: 106,881,427 (GRCm39) I188T probably damaging Het
Slc27a4 A T 2: 29,695,672 (GRCm39) Y69F probably benign Het
Slc3a1 T C 17: 85,340,319 (GRCm39) V247A probably benign Het
Slc4a2 C T 5: 24,643,772 (GRCm39) T854I probably benign Het
Stat5b G A 11: 100,674,001 (GRCm39) T761M probably damaging Het
Stkld1 T C 2: 26,842,717 (GRCm39) L563P probably damaging Het
Tbc1d23 C A 16: 57,018,672 (GRCm39) C283F probably benign Het
Tkfc T C 19: 10,571,927 (GRCm39) T370A probably benign Het
Tpr T C 1: 150,311,604 (GRCm39) V1868A possibly damaging Het
Triobp T A 15: 78,857,833 (GRCm39) W1145R probably damaging Het
Vmn2r82 T G 10: 79,232,025 (GRCm39) L675V probably damaging Het
Zfp423 T C 8: 88,508,637 (GRCm39) E444G probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGGTCAAGATACAAATCTCACAG -3'
(R):5'- GTCTTTGCTGACTACCGAACC -3'

Sequencing Primer
(F):5'- GCAAAATTTGAAAGCTGCTGTG -3'
(R):5'- GACTACCGAACCCTCTCTGG -3'
Posted On 2016-10-26