Incidental Mutation 'R5601:Atn1'
ID439022
Institutional Source Beutler Lab
Gene Symbol Atn1
Ensembl Gene ENSMUSG00000004263
Gene Nameatrophin 1
Synonymsatrophin-1, Drpla, Atr1
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124742544-124756524 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 124743228 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000004389] [ENSMUST00000088357] [ENSMUST00000129411] [ENSMUST00000146872] [ENSMUST00000171549] [ENSMUST00000174265]
Predicted Effect probably benign
Transcript: ENSMUST00000004377
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000004389
SMART Domains Protein: ENSMUSP00000004389
Gene: ENSMUSG00000072772

DomainStartEndE-ValueType
Pfam:DUF4511 11 113 5e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088357
SMART Domains Protein: ENSMUSP00000085695
Gene: ENSMUSG00000004263

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 191 7.9e-30 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
low complexity region 351 372 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
Pfam:Atrophin-1 405 1174 4.6e-209 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129411
SMART Domains Protein: ENSMUSP00000115407
Gene: ENSMUSG00000107478

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 164 3.8e-33 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
Pfam:Atrophin-1 327 1175 1.7e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140423
Predicted Effect probably benign
Transcript: ENSMUST00000146872
SMART Domains Protein: ENSMUSP00000123560
Gene: ENSMUSG00000004263

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 182 2.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158458
Predicted Effect probably benign
Transcript: ENSMUST00000171549
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174265
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice are viable and fertile, however mice expressing a truncated protein lacking the poly-Q repeat and C-terminal peptides display growth retardation, progressive male infertility with small testis and low sperm counts, and consume less food. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Atn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Atn1 APN 6 124749276 missense probably damaging 0.96
Janvier UTSW 6 124744956 unclassified probably benign
R0122:Atn1 UTSW 6 124743234 unclassified probably benign
R0227:Atn1 UTSW 6 124746930 unclassified probably benign
R0385:Atn1 UTSW 6 124743371 unclassified probably benign
R0394:Atn1 UTSW 6 124749733 splice site probably benign
R0834:Atn1 UTSW 6 124743225 unclassified probably benign
R1295:Atn1 UTSW 6 124747787 missense unknown
R1296:Atn1 UTSW 6 124747787 missense unknown
R1865:Atn1 UTSW 6 124745296 unclassified probably benign
R1992:Atn1 UTSW 6 124745328 unclassified probably benign
R2268:Atn1 UTSW 6 124746240 unclassified probably benign
R3826:Atn1 UTSW 6 124746219 unclassified probably benign
R4903:Atn1 UTSW 6 124743257 unclassified probably benign
R5680:Atn1 UTSW 6 124747815 missense possibly damaging 0.92
R6167:Atn1 UTSW 6 124746737 unclassified probably benign
R6314:Atn1 UTSW 6 124747050 unclassified probably benign
R6427:Atn1 UTSW 6 124746176 unclassified probably benign
R6538:Atn1 UTSW 6 124746549 unclassified probably benign
R6606:Atn1 UTSW 6 124744956 unclassified probably benign
R7240:Atn1 UTSW 6 124747898 missense unknown
R8090:Atn1 UTSW 6 124745341 missense unknown
Z1177:Atn1 UTSW 6 124745035 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGGATCGCAGCTCTACAG -3'
(R):5'- TGGAACGTTGGCTGACTGTC -3'

Sequencing Primer
(F):5'- ACAGCGGCTTGTCACTC -3'
(R):5'- TGACTGTCCCCATCCAGCAG -3'
Posted On2016-10-26