Incidental Mutation 'R5601:Stat5b'
ID439035
Institutional Source Beutler Lab
Gene Symbol Stat5b
Ensembl Gene ENSMUSG00000020919
Gene Namesignal transducer and activator of transcription 5B
Synonyms
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100780731-100850724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100783175 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 761 (T761M)
Ref Sequence ENSEMBL: ENSMUSP00000102981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004143] [ENSMUST00000107358]
Predicted Effect probably damaging
Transcript: ENSMUST00000004143
AA Change: T761M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004143
Gene: ENSMUSG00000020919
AA Change: T761M

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 138 330 1e-57 PFAM
Pfam:STAT_bind 332 583 1.6e-100 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107358
AA Change: T761M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102981
Gene: ENSMUSG00000020919
AA Change: T761M

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 141 330 7.1e-56 PFAM
Pfam:STAT_bind 332 582 3.3e-105 PFAM
SH2 587 676 3.23e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this are reduced in size and mammary glands secrete reduced levels of some milk proteins during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Stat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Stat5b APN 11 100804913 missense probably damaging 1.00
IGL02675:Stat5b APN 11 100787374 missense probably benign 0.26
IGL02683:Stat5b APN 11 100804946 missense probably benign 0.11
IGL02725:Stat5b APN 11 100805014 missense possibly damaging 0.91
R0305:Stat5b UTSW 11 100802503 missense probably benign 0.00
R0315:Stat5b UTSW 11 100788460 missense probably benign 0.01
R0452:Stat5b UTSW 11 100798330 missense probably benign 0.00
R1267:Stat5b UTSW 11 100798593 missense probably benign 0.08
R1527:Stat5b UTSW 11 100808394 critical splice donor site probably null
R2059:Stat5b UTSW 11 100787332 missense probably benign 0.12
R2316:Stat5b UTSW 11 100796492 missense probably damaging 1.00
R2990:Stat5b UTSW 11 100808362 intron probably null
R4380:Stat5b UTSW 11 100787349 missense probably damaging 1.00
R4478:Stat5b UTSW 11 100787284 missense probably benign 0.31
R4584:Stat5b UTSW 11 100787238 missense probably damaging 1.00
R4806:Stat5b UTSW 11 100790797 missense probably benign
R4931:Stat5b UTSW 11 100784254 nonsense probably null
R5008:Stat5b UTSW 11 100802483 missense probably benign 0.00
R5015:Stat5b UTSW 11 100805005 missense possibly damaging 0.64
R5072:Stat5b UTSW 11 100808535 critical splice acceptor site probably null
R5638:Stat5b UTSW 11 100784254 nonsense probably null
R5901:Stat5b UTSW 11 100804907 missense possibly damaging 0.62
R6577:Stat5b UTSW 11 100797700 missense probably benign 0.00
R7882:Stat5b UTSW 11 100783775 missense possibly damaging 0.55
R8147:Stat5b UTSW 11 100797781 missense probably benign 0.06
R8188:Stat5b UTSW 11 100801436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACTATGCACAGAGAC -3'
(R):5'- TGATGACCTAGCCAGCAAAG -3'

Sequencing Primer
(F):5'- ACTTCACATTACGAGTATTGTTTCC -3'
(R):5'- AGCAAAGGCCTCTCTGATTTC -3'
Posted On2016-10-26