Incidental Mutation 'R5601:P4hb'
ID439036
Institutional Source Beutler Lab
Gene Symbol P4hb
Ensembl Gene ENSMUSG00000025130
Gene Nameprolyl 4-hydroxylase, beta polypeptide
SynonymsThbp, protein disulfide isomerase, ERp59, PDI, Pdia1
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120560298-120573253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120571615 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 88 (E88D)
Ref Sequence ENSEMBL: ENSMUSP00000026122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026122] [ENSMUST00000168360]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026122
AA Change: E88D

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026122
Gene: ENSMUSG00000025130
AA Change: E88D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 134 4.9e-37 PFAM
Pfam:Thioredoxin_2 39 126 3.5e-9 PFAM
Pfam:Thioredoxin_6 163 347 8.3e-44 PFAM
Pfam:Thioredoxin 370 475 1.5e-30 PFAM
low complexity region 478 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168360
SMART Domains Protein: ENSMUSP00000128796
Gene: ENSMUSG00000025130

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 131 6e-32 PFAM
low complexity region 134 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele and conditional allele activated in immune cells exhibit impaired neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in P4hb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:P4hb APN 11 120563818 missense probably benign 0.00
R0042:P4hb UTSW 11 120568266 missense probably damaging 1.00
R0042:P4hb UTSW 11 120568266 missense probably damaging 1.00
R0362:P4hb UTSW 11 120563336 missense probably benign 0.04
R0597:P4hb UTSW 11 120568244 missense possibly damaging 0.53
R1458:P4hb UTSW 11 120562555 splice site probably benign
R1635:P4hb UTSW 11 120571616 missense probably damaging 0.97
R1750:P4hb UTSW 11 120562720 missense probably damaging 0.99
R1773:P4hb UTSW 11 120572726 missense probably damaging 1.00
R1856:P4hb UTSW 11 120563218 missense probably benign 0.23
R1874:P4hb UTSW 11 120562166 missense probably benign
R2014:P4hb UTSW 11 120562696 missense probably damaging 0.98
R2239:P4hb UTSW 11 120563282 missense probably damaging 1.00
R2331:P4hb UTSW 11 120568280 missense probably benign 0.00
R3935:P4hb UTSW 11 120562409 missense probably benign 0.20
R3936:P4hb UTSW 11 120562409 missense probably benign 0.20
R5893:P4hb UTSW 11 120571650 missense probably damaging 1.00
R6533:P4hb UTSW 11 120571643 missense probably damaging 1.00
R8243:P4hb UTSW 11 120563380 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTGAGAACAGGGCCTCTC -3'
(R):5'- TCTCTTGACTGCATTAAGAGGGG -3'

Sequencing Primer
(F):5'- TTTGCTCCCAAAGCCTAC -3'
(R):5'- CTTGACTGCATTAAGAGGGGTTATC -3'
Posted On2016-10-26