Incidental Mutation 'R5601:Gm10436'
ID439037
Institutional Source Beutler Lab
Gene Symbol Gm10436
Ensembl Gene ENSMUSG00000066027
Gene Namepredicted gene 10436
Synonyms
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location88175589-88182108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88176047 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 267 (D267G)
Ref Sequence ENSEMBL: ENSMUSP00000152292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071580] [ENSMUST00000220521] [ENSMUST00000222081] [ENSMUST00000223172]
Predicted Effect probably damaging
Transcript: ENSMUST00000071580
AA Change: D462G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071508
Gene: ENSMUSG00000066027
AA Change: D462G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 247 445 5e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220521
AA Change: D267G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221884
Predicted Effect probably benign
Transcript: ENSMUST00000222081
Predicted Effect probably benign
Transcript: ENSMUST00000222391
Predicted Effect probably benign
Transcript: ENSMUST00000222556
Predicted Effect probably benign
Transcript: ENSMUST00000223172
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Gm10436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gm10436 APN 12 88177112 missense probably benign 0.35
IGL01391:Gm10436 APN 12 88178455 missense possibly damaging 0.84
IGL01432:Gm10436 APN 12 88176432 missense probably benign 0.44
IGL01519:Gm10436 APN 12 88177561 missense probably benign 0.00
IGL01784:Gm10436 APN 12 88176315 missense probably benign
IGL02121:Gm10436 APN 12 88178472 missense possibly damaging 0.83
IGL02728:Gm10436 APN 12 88176022 missense probably benign 0.17
R0336:Gm10436 UTSW 12 88178191 missense probably benign 0.20
R0554:Gm10436 UTSW 12 88177558 missense probably benign 0.10
R1279:Gm10436 UTSW 12 88175880 missense probably benign 0.42
R1832:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1833:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1900:Gm10436 UTSW 12 88177260 missense probably benign 0.02
R2412:Gm10436 UTSW 12 88177110 missense probably damaging 0.98
R3040:Gm10436 UTSW 12 88178348 missense probably benign 0.00
R3625:Gm10436 UTSW 12 88175961 missense probably benign 0.06
R4078:Gm10436 UTSW 12 88175913 missense probably benign 0.38
R4270:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R4271:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R5318:Gm10436 UTSW 12 88176228 missense probably benign 0.01
R5552:Gm10436 UTSW 12 88178365 missense probably benign 0.03
R5881:Gm10436 UTSW 12 88176341 missense probably damaging 1.00
R5973:Gm10436 UTSW 12 88175913 missense probably benign 0.02
R6058:Gm10436 UTSW 12 88177225 missense possibly damaging 0.91
R6488:Gm10436 UTSW 12 88177587 missense possibly damaging 0.87
R6656:Gm10436 UTSW 12 88175993 missense possibly damaging 0.89
R7307:Gm10436 UTSW 12 88181749 missense probably damaging 1.00
R7332:Gm10436 UTSW 12 88176417 missense possibly damaging 0.72
R7544:Gm10436 UTSW 12 88176080 missense probably benign 0.00
R7569:Gm10436 UTSW 12 88176315 missense probably benign
R7645:Gm10436 UTSW 12 88176258 missense probably damaging 1.00
R7752:Gm10436 UTSW 12 88175999 missense probably damaging 1.00
R7855:Gm10436 UTSW 12 88176083 missense probably benign 0.03
R7860:Gm10436 UTSW 12 88176352 missense possibly damaging 0.89
R8113:Gm10436 UTSW 12 88177080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTATCATAGTTCCACAAAACGGC -3'
(R):5'- GGAGATACCCTGAAAACCCTGG -3'

Sequencing Primer
(F):5'- GCAACATTGGGTATGCCGATC -3'
(R):5'- GATACCCTGAAAACCCTGGAATTGG -3'
Posted On2016-10-26