Incidental Mutation 'R5601:Bltp3a'
ID 439045
Institutional Source Beutler Lab
Gene Symbol Bltp3a
Ensembl Gene ENSMUSG00000039512
Gene Name bridge-like lipid transfer protein family member 3A
Synonyms 1110020K19Rik, F830021D11Rik, Uhrf1bp1
MMRRC Submission 043153-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5601 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 27856490-27900040 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 27884494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 392 (A392D)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
AlphaFold B2KF50
Predicted Effect probably damaging
Transcript: ENSMUST00000114849
AA Change: A392D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: A392D

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130810
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 (GRCm38) V426I probably benign Het
Asmt T C X: 170,676,392 (GRCm38) V212A probably damaging Het
Atn1 A G 6: 124,743,228 (GRCm38) probably null Het
Auts2 G T 5: 131,476,823 (GRCm38) probably benign Het
AW551984 C T 9: 39,591,267 (GRCm38) V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 (GRCm38) Q114* probably null Het
Ces2e A T 8: 104,929,494 (GRCm38) I146F probably benign Het
Cfap44 A G 16: 44,460,186 (GRCm38) K1443E probably damaging Het
Cma2 T A 14: 55,973,789 (GRCm38) H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 (GRCm38) probably null Het
Cwh43 A G 5: 73,417,940 (GRCm38) probably null Het
Dnajb12 GC G 10: 59,892,752 (GRCm38) probably null Het
Dram1 A G 10: 88,324,767 (GRCm38) S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 (GRCm38) D482G probably damaging Het
Fstl1 T C 16: 37,826,799 (GRCm38) I177T probably benign Het
Fut9 T C 4: 25,620,299 (GRCm38) T172A probably benign Het
Gm5134 G A 10: 75,985,952 (GRCm38) V207M probably damaging Het
Hccs G A X: 169,313,601 (GRCm38) R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 (GRCm38) F877I probably damaging Het
Ide A G 19: 37,314,980 (GRCm38) V272A unknown Het
Impact C T 18: 12,976,007 (GRCm38) T65I probably benign Het
Lgr6 C T 1: 134,994,010 (GRCm38) A199T probably damaging Het
Muc17 A G 5: 137,138,015 (GRCm38) S309P probably damaging Het
Myf6 A C 10: 107,494,614 (GRCm38) S31A probably damaging Het
Or4n4b C A 14: 50,298,861 (GRCm38) W149C probably damaging Het
Or8b35 C G 9: 37,992,714 (GRCm38) T74R possibly damaging Het
P4hb T A 11: 120,571,615 (GRCm38) E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 (GRCm38) C418R probably damaging Het
Pramel51 T C 12: 88,176,047 (GRCm38) D267G probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 (GRCm38) probably null Het
Prss58 A T 6: 40,897,849 (GRCm38) N19K possibly damaging Het
Ptprq C T 10: 107,608,430 (GRCm38) A1438T probably benign Het
Rfx4 A T 10: 84,798,578 (GRCm38) T61S probably damaging Het
Sclt1 T A 3: 41,730,919 (GRCm38) N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 (GRCm38) probably benign Het
Serpinb12 T C 1: 106,953,697 (GRCm38) I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 (GRCm38) Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 (GRCm38) V247A probably benign Het
Slc4a2 C T 5: 24,438,774 (GRCm38) T854I probably benign Het
Stat5b G A 11: 100,783,175 (GRCm38) T761M probably damaging Het
Stkld1 T C 2: 26,952,705 (GRCm38) L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 (GRCm38) C283F probably benign Het
Tcaf3 T C 6: 42,587,528 (GRCm38) N900S possibly damaging Het
Tkfc T C 19: 10,594,563 (GRCm38) T370A probably benign Het
Tpr T C 1: 150,435,853 (GRCm38) V1868A possibly damaging Het
Triobp T A 15: 78,973,633 (GRCm38) W1145R probably damaging Het
Vmn2r82 T G 10: 79,396,191 (GRCm38) L675V probably damaging Het
Zfp423 T C 8: 87,782,009 (GRCm38) E444G probably damaging Het
Other mutations in Bltp3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Bltp3a APN 17 27,876,917 (GRCm38) splice site probably benign
IGL00786:Bltp3a APN 17 27,879,292 (GRCm38) missense probably damaging 0.99
IGL01074:Bltp3a APN 17 27,879,291 (GRCm38) missense possibly damaging 0.94
IGL01780:Bltp3a APN 17 27,893,500 (GRCm38) missense probably damaging 1.00
IGL02668:Bltp3a APN 17 27,886,575 (GRCm38) missense possibly damaging 0.53
IGL02686:Bltp3a APN 17 27,894,589 (GRCm38) missense probably benign
IGL03240:Bltp3a APN 17 27,893,253 (GRCm38) missense probably benign 0.37
hades UTSW 17 27,894,746 (GRCm38) missense probably damaging 1.00
R0167:Bltp3a UTSW 17 27,880,202 (GRCm38) missense possibly damaging 0.46
R0240:Bltp3a UTSW 17 27,895,870 (GRCm38) splice site probably benign
R0332:Bltp3a UTSW 17 27,893,294 (GRCm38) critical splice donor site probably null
R0668:Bltp3a UTSW 17 27,895,939 (GRCm38) missense probably benign 0.16
R0726:Bltp3a UTSW 17 27,885,489 (GRCm38) missense possibly damaging 0.50
R0964:Bltp3a UTSW 17 27,887,178 (GRCm38) missense probably damaging 0.96
R1125:Bltp3a UTSW 17 27,893,449 (GRCm38) missense probably damaging 1.00
R1139:Bltp3a UTSW 17 27,890,071 (GRCm38) missense possibly damaging 0.87
R1164:Bltp3a UTSW 17 27,895,380 (GRCm38) critical splice donor site probably null
R1192:Bltp3a UTSW 17 27,890,071 (GRCm38) missense possibly damaging 0.87
R1277:Bltp3a UTSW 17 27,890,071 (GRCm38) missense possibly damaging 0.87
R1279:Bltp3a UTSW 17 27,890,071 (GRCm38) missense possibly damaging 0.87
R1340:Bltp3a UTSW 17 27,894,721 (GRCm38) missense probably benign 0.00
R1341:Bltp3a UTSW 17 27,877,419 (GRCm38) splice site probably benign
R1344:Bltp3a UTSW 17 27,894,577 (GRCm38) missense probably benign 0.41
R1418:Bltp3a UTSW 17 27,894,577 (GRCm38) missense probably benign 0.41
R1552:Bltp3a UTSW 17 27,890,071 (GRCm38) missense possibly damaging 0.87
R1726:Bltp3a UTSW 17 27,886,251 (GRCm38) splice site probably null
R1791:Bltp3a UTSW 17 27,894,746 (GRCm38) missense probably damaging 1.00
R1796:Bltp3a UTSW 17 27,890,071 (GRCm38) missense possibly damaging 0.87
R2858:Bltp3a UTSW 17 27,885,462 (GRCm38) missense probably damaging 0.99
R3034:Bltp3a UTSW 17 27,894,746 (GRCm38) missense probably damaging 1.00
R4111:Bltp3a UTSW 17 27,886,090 (GRCm38) nonsense probably null
R4159:Bltp3a UTSW 17 27,884,087 (GRCm38) missense probably damaging 1.00
R4160:Bltp3a UTSW 17 27,884,087 (GRCm38) missense probably damaging 1.00
R4161:Bltp3a UTSW 17 27,884,087 (GRCm38) missense probably damaging 1.00
R4431:Bltp3a UTSW 17 27,885,931 (GRCm38) missense probably damaging 1.00
R4575:Bltp3a UTSW 17 27,887,503 (GRCm38) missense probably benign 0.02
R4657:Bltp3a UTSW 17 27,890,105 (GRCm38) missense probably benign 0.09
R4666:Bltp3a UTSW 17 27,893,503 (GRCm38) missense possibly damaging 0.95
R4825:Bltp3a UTSW 17 27,877,394 (GRCm38) missense probably damaging 0.98
R4872:Bltp3a UTSW 17 27,890,136 (GRCm38) missense probably benign 0.10
R4956:Bltp3a UTSW 17 27,889,984 (GRCm38) splice site probably null
R4976:Bltp3a UTSW 17 27,884,026 (GRCm38) missense probably damaging 0.99
R4982:Bltp3a UTSW 17 27,886,606 (GRCm38) missense probably benign 0.05
R5017:Bltp3a UTSW 17 27,894,739 (GRCm38) nonsense probably null
R5033:Bltp3a UTSW 17 27,886,864 (GRCm38) missense probably damaging 0.99
R5137:Bltp3a UTSW 17 27,876,990 (GRCm38) splice site probably null
R5159:Bltp3a UTSW 17 27,881,556 (GRCm38) missense probably damaging 0.98
R5177:Bltp3a UTSW 17 27,885,018 (GRCm38) missense possibly damaging 0.94
R5196:Bltp3a UTSW 17 27,856,763 (GRCm38) missense probably benign 0.09
R5214:Bltp3a UTSW 17 27,887,515 (GRCm38) missense probably benign
R5352:Bltp3a UTSW 17 27,887,515 (GRCm38) missense probably benign
R5354:Bltp3a UTSW 17 27,887,515 (GRCm38) missense probably benign
R5425:Bltp3a UTSW 17 27,887,515 (GRCm38) missense probably benign
R6080:Bltp3a UTSW 17 27,880,297 (GRCm38) missense probably benign
R6088:Bltp3a UTSW 17 27,884,605 (GRCm38) critical splice donor site probably null
R6331:Bltp3a UTSW 17 27,893,201 (GRCm38) missense probably benign 0.01
R6529:Bltp3a UTSW 17 27,879,776 (GRCm38) missense possibly damaging 0.90
R6614:Bltp3a UTSW 17 27,876,925 (GRCm38) missense probably benign 0.18
R6701:Bltp3a UTSW 17 27,887,357 (GRCm38) nonsense probably null
R7082:Bltp3a UTSW 17 27,890,065 (GRCm38) missense probably damaging 1.00
R7158:Bltp3a UTSW 17 27,886,433 (GRCm38) nonsense probably null
R8338:Bltp3a UTSW 17 27,876,695 (GRCm38) missense probably damaging 1.00
R8914:Bltp3a UTSW 17 27,886,913 (GRCm38) missense possibly damaging 0.66
R9135:Bltp3a UTSW 17 27,885,928 (GRCm38) nonsense probably null
R9218:Bltp3a UTSW 17 27,895,555 (GRCm38) missense probably benign 0.00
R9421:Bltp3a UTSW 17 27,876,686 (GRCm38) missense probably damaging 1.00
R9495:Bltp3a UTSW 17 27,893,440 (GRCm38) missense probably damaging 1.00
R9514:Bltp3a UTSW 17 27,893,440 (GRCm38) missense probably damaging 1.00
R9621:Bltp3a UTSW 17 27,886,779 (GRCm38) missense probably benign 0.00
R9766:Bltp3a UTSW 17 27,886,825 (GRCm38) missense probably damaging 1.00
RF005:Bltp3a UTSW 17 27,885,531 (GRCm38) missense probably damaging 1.00
X0017:Bltp3a UTSW 17 27,877,341 (GRCm38) missense probably benign 0.03
Z1176:Bltp3a UTSW 17 27,886,306 (GRCm38) missense probably damaging 1.00
Z1176:Bltp3a UTSW 17 27,876,676 (GRCm38) missense probably damaging 1.00
Z1177:Bltp3a UTSW 17 27,884,966 (GRCm38) missense not run
Predicted Primers PCR Primer
(F):5'- GTAGTCCAGAGCCAGAAGTG -3'
(R):5'- AGAGACAGTGCTTCACCTCCAC -3'

Sequencing Primer
(F):5'- AGAAGTGGCCCCTTCCTC -3'
(R):5'- TTCACCTCCACCAGCTACTTAAAG -3'
Posted On 2016-10-26