Incidental Mutation 'R5601:Slc3a1'
ID439046
Institutional Source Beutler Lab
Gene Symbol Slc3a1
Ensembl Gene ENSMUSG00000024131
Gene Namesolute carrier family 3, member 1
SynonymsNTAA, D2H
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location85028347-85064243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85032891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 247 (V247A)
Ref Sequence ENSEMBL: ENSMUSP00000024944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024944]
Predicted Effect probably benign
Transcript: ENSMUST00000024944
AA Change: V247A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024944
Gene: ENSMUSG00000024131
AA Change: V247A

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
Aamy 124 504 6.7e-110 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II membrane glycoprotein which is one of the components of the renal amino acid transporter which transports neutral and basic amino acids in the renal tubule and intestinal tract. Mutations and deletions in this gene are associated with cystinuria. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this locus results in renal absorption defects and cystine urolithiasis. Homozygous mutant mice serve as a mouse model for human cystinuria type I. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Slc3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc3a1 APN 17 85060833 missense probably damaging 1.00
IGL00647:Slc3a1 APN 17 85063805 missense probably damaging 0.99
IGL02755:Slc3a1 APN 17 85037177 missense probably damaging 1.00
IGL03079:Slc3a1 APN 17 85059823 nonsense probably null
IGL03390:Slc3a1 APN 17 85032777 missense probably damaging 1.00
R0031:Slc3a1 UTSW 17 85032846 missense probably damaging 1.00
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0363:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R0531:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R0636:Slc3a1 UTSW 17 85032794 missense possibly damaging 0.78
R0662:Slc3a1 UTSW 17 85037207 missense possibly damaging 0.89
R0725:Slc3a1 UTSW 17 85060835 nonsense probably null
R0930:Slc3a1 UTSW 17 85059743 missense probably benign 0.01
R1141:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R2025:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R2271:Slc3a1 UTSW 17 85063792 missense probably benign 0.00
R4196:Slc3a1 UTSW 17 85060878 missense probably damaging 1.00
R4740:Slc3a1 UTSW 17 85046753 missense probably benign 0.00
R5049:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R5255:Slc3a1 UTSW 17 85028453 unclassified probably null
R5261:Slc3a1 UTSW 17 85051975 missense probably damaging 1.00
R5853:Slc3a1 UTSW 17 85032580 missense probably damaging 1.00
R6063:Slc3a1 UTSW 17 85028523 missense probably benign
R6332:Slc3a1 UTSW 17 85028432 start codon destroyed probably damaging 0.99
R7162:Slc3a1 UTSW 17 85064014 nonsense probably null
R7269:Slc3a1 UTSW 17 85032445 missense probably damaging 1.00
R7516:Slc3a1 UTSW 17 85063762 missense probably damaging 1.00
R7807:Slc3a1 UTSW 17 85063943 missense probably benign 0.09
R8269:Slc3a1 UTSW 17 85032554 missense probably benign 0.00
R8351:Slc3a1 UTSW 17 85028496 missense possibly damaging 0.68
R8361:Slc3a1 UTSW 17 85037212 nonsense probably null
X0020:Slc3a1 UTSW 17 85028808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAATCAGTTCCTAACGTTTG -3'
(R):5'- ACCTATGCTGGACAAGGTGG -3'

Sequencing Primer
(F):5'- GCAATCAGTTCCTAACGTTTGATGTG -3'
(R):5'- TGTCACAAACCTAAAAGCTCTTGGG -3'
Posted On2016-10-26