Incidental Mutation 'R5601:Pcdhb9'
ID439048
Institutional Source Beutler Lab
Gene Symbol Pcdhb9
Ensembl Gene ENSMUSG00000051242
Gene Nameprotocadherin beta 9
SynonymsPcdhbI, Pcdhb4C
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37400855-37403909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37402206 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 418 (C418R)
Ref Sequence ENSEMBL: ENSMUSP00000058801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057228] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000057228
AA Change: C418R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058801
Gene: ENSMUSG00000051242
AA Change: C418R

DomainStartEndE-ValueType
Pfam:Cadherin_2 65 147 2.3e-33 PFAM
CA 190 275 1.28e-17 SMART
CA 299 380 7.6e-25 SMART
CA 403 484 5.81e-21 SMART
CA 508 594 9.8e-28 SMART
CA 624 705 1.86e-10 SMART
Pfam:Cadherin_C_2 722 805 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Pcdhb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pcdhb9 APN 18 37403279 missense possibly damaging 0.59
IGL01557:Pcdhb9 APN 18 37403047 missense probably damaging 1.00
IGL01716:Pcdhb9 APN 18 37403175 missense probably damaging 0.99
IGL01954:Pcdhb9 APN 18 37401741 missense probably damaging 1.00
IGL02063:Pcdhb9 APN 18 37401757 missense probably benign 0.21
IGL03057:Pcdhb9 APN 18 37401277 missense probably benign 0.00
R0140:Pcdhb9 UTSW 18 37402961 missense possibly damaging 0.89
R0180:Pcdhb9 UTSW 18 37402254 missense probably damaging 1.00
R0349:Pcdhb9 UTSW 18 37402579 missense probably damaging 0.99
R0616:Pcdhb9 UTSW 18 37401975 nonsense probably null
R0669:Pcdhb9 UTSW 18 37402255 missense probably damaging 1.00
R1256:Pcdhb9 UTSW 18 37403116 missense possibly damaging 0.94
R1642:Pcdhb9 UTSW 18 37400934 intron probably benign
R1678:Pcdhb9 UTSW 18 37401629 missense probably damaging 1.00
R1711:Pcdhb9 UTSW 18 37403327 nonsense probably null
R1762:Pcdhb9 UTSW 18 37403083 missense probably benign 0.00
R1823:Pcdhb9 UTSW 18 37402818 missense probably benign 0.14
R1868:Pcdhb9 UTSW 18 37402084 missense probably damaging 1.00
R1959:Pcdhb9 UTSW 18 37403316 missense probably damaging 1.00
R2446:Pcdhb9 UTSW 18 37403287 missense probably damaging 0.99
R2889:Pcdhb9 UTSW 18 37403223 missense probably benign 0.06
R2890:Pcdhb9 UTSW 18 37403326 missense probably benign 0.23
R3196:Pcdhb9 UTSW 18 37401610 missense probably benign 0.02
R3725:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R3726:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R4179:Pcdhb9 UTSW 18 37401115 missense probably benign 0.17
R4326:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4326:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4327:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4327:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4329:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4329:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4626:Pcdhb9 UTSW 18 37402249 missense probably benign 0.01
R4738:Pcdhb9 UTSW 18 37403415 missense probably benign 0.33
R4888:Pcdhb9 UTSW 18 37403233 missense probably benign 0.22
R5140:Pcdhb9 UTSW 18 37401133 missense probably benign 0.00
R5186:Pcdhb9 UTSW 18 37401232 missense probably damaging 1.00
R5502:Pcdhb9 UTSW 18 37401603 missense possibly damaging 0.95
R5586:Pcdhb9 UTSW 18 37401114 missense probably benign
R5624:Pcdhb9 UTSW 18 37401406 missense probably benign
R5827:Pcdhb9 UTSW 18 37401958 missense possibly damaging 0.72
R5829:Pcdhb9 UTSW 18 37401889 missense probably damaging 0.97
R5837:Pcdhb9 UTSW 18 37402798 missense probably damaging 1.00
R6147:Pcdhb9 UTSW 18 37402441 missense possibly damaging 0.95
R6228:Pcdhb9 UTSW 18 37402062 missense probably benign 0.00
R6245:Pcdhb9 UTSW 18 37403154 missense probably damaging 1.00
R6304:Pcdhb9 UTSW 18 37401367 missense probably damaging 0.99
R6542:Pcdhb9 UTSW 18 37401589 missense probably damaging 0.99
R6904:Pcdhb9 UTSW 18 37401917 missense probably benign 0.01
R7058:Pcdhb9 UTSW 18 37403281 missense probably benign 0.35
R7159:Pcdhb9 UTSW 18 37401492 missense possibly damaging 0.89
R7258:Pcdhb9 UTSW 18 37402114 missense probably damaging 1.00
R7800:Pcdhb9 UTSW 18 37401549 missense probably benign 0.01
R8027:Pcdhb9 UTSW 18 37403016 missense possibly damaging 0.81
R8141:Pcdhb9 UTSW 18 37402308 missense probably damaging 1.00
R8157:Pcdhb9 UTSW 18 37403155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACCATGTGGAAATCGAGG -3'
(R):5'- TTGTCGTTGATGTCGGACAC -3'

Sequencing Primer
(F):5'- TTACCATGTGGAAATCGAGGCCATAG -3'
(R):5'- TTGATGTCGGACACCTGCAC -3'
Posted On2016-10-26