Incidental Mutation 'R5601:Tkfc'
ID439049
Institutional Source Beutler Lab
Gene Symbol Tkfc
Ensembl Gene ENSMUSG00000034371
Gene Nametriokinase, FMN cyclase
SynonymsDak
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10592200-10604258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10594563 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 370 (T370A)
Ref Sequence ENSEMBL: ENSMUSP00000044556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037678]
Predicted Effect probably benign
Transcript: ENSMUST00000037678
AA Change: T370A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371
AA Change: T370A

DomainStartEndE-ValueType
Pfam:Dak1 19 335 1.9e-112 PFAM
low complexity region 352 366 N/A INTRINSIC
Dak2 398 571 1.47e-58 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Tkfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tkfc APN 19 10594528 missense probably benign 0.28
IGL01149:Tkfc APN 19 10600651 missense probably damaging 1.00
IGL02726:Tkfc APN 19 10596212 missense possibly damaging 0.67
IGL03069:Tkfc APN 19 10599154 missense probably benign
R1367:Tkfc UTSW 19 10593474 missense probably benign 0.19
R1476:Tkfc UTSW 19 10595326 missense probably null 0.55
R2081:Tkfc UTSW 19 10597378 missense probably damaging 1.00
R2130:Tkfc UTSW 19 10596041 missense probably damaging 0.97
R2151:Tkfc UTSW 19 10599057 missense probably damaging 1.00
R2443:Tkfc UTSW 19 10594538 missense probably damaging 0.97
R3104:Tkfc UTSW 19 10596993 nonsense probably null
R3105:Tkfc UTSW 19 10596993 nonsense probably null
R3106:Tkfc UTSW 19 10596993 nonsense probably null
R5027:Tkfc UTSW 19 10592659 unclassified probably null
R5637:Tkfc UTSW 19 10594533 missense probably benign 0.00
R5933:Tkfc UTSW 19 10597347 missense probably benign 0.17
R6792:Tkfc UTSW 19 10594524 missense probably benign
R6845:Tkfc UTSW 19 10599332 missense probably damaging 0.99
R6909:Tkfc UTSW 19 10596266 missense probably benign 0.06
R7007:Tkfc UTSW 19 10596363 missense probably benign
R7883:Tkfc UTSW 19 10595030 intron probably null
Predicted Primers PCR Primer
(F):5'- TCTAAGAGCTAGTGTGCCATATTG -3'
(R):5'- AAGGTCTCTGTGACTGGGAG -3'

Sequencing Primer
(F):5'- TATTGGCCCAAGTGTCCCAAAG -3'
(R):5'- CTCTGTGACTGGGAGGAAGC -3'
Posted On2016-10-26