Incidental Mutation 'R5601:Ide'
ID439050
Institutional Source Beutler Lab
Gene Symbol Ide
Ensembl Gene ENSMUSG00000056999
Gene Nameinsulin degrading enzyme
Synonyms
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5601 (G1)
Quality Score207
Status Not validated
Chromosome19
Chromosomal Location37268743-37337852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37314980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000131070
AA Change: V272A
SMART Domains Protein: ENSMUSP00000121358
Gene: ENSMUSG00000056999
AA Change: V272A

DomainStartEndE-ValueType
Pfam:Peptidase_M16 42 180 8.1e-49 PFAM
Pfam:Peptidase_M16_C 205 385 2.1e-25 PFAM
Pfam:Peptidase_M16_M 389 671 1.9e-106 PFAM
Pfam:Peptidase_M16_C 674 857 9.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154308
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption of this gene display beta amyloid accumulations in the brain, hyperinsulinemia and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Ide
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ide APN 19 37276532 missense unknown
IGL01924:Ide APN 19 37272164 missense unknown
IGL01925:Ide APN 19 37277897 missense unknown
IGL02616:Ide APN 19 37298056 missense unknown
R0738:Ide UTSW 19 37277965 nonsense probably null
R1509:Ide UTSW 19 37285204 critical splice donor site probably null
R1557:Ide UTSW 19 37280761 splice site probably null
R2935:Ide UTSW 19 37325307 missense unknown
R4260:Ide UTSW 19 37329186 missense unknown
R4261:Ide UTSW 19 37329186 missense unknown
R4575:Ide UTSW 19 37272205 missense unknown
R4913:Ide UTSW 19 37329070 missense unknown
R4933:Ide UTSW 19 37277756 missense unknown
R4951:Ide UTSW 19 37285232 missense unknown
R5102:Ide UTSW 19 37314984 missense unknown
R5474:Ide UTSW 19 37272184 missense unknown
R5502:Ide UTSW 19 37330456 missense unknown
R5546:Ide UTSW 19 37272224 missense unknown
R5696:Ide UTSW 19 37318021 missense unknown
R5884:Ide UTSW 19 37272153 critical splice donor site probably null
R5983:Ide UTSW 19 37272150 splice site probably null
R6286:Ide UTSW 19 37278010 missense unknown
R7146:Ide UTSW 19 37295944 missense
R7224:Ide UTSW 19 37290761 missense
R7234:Ide UTSW 19 37290785 missense
R7695:Ide UTSW 19 37329036 missense
R7771:Ide UTSW 19 37298126 missense
R7811:Ide UTSW 19 37330511 missense
R7893:Ide UTSW 19 37284151 missense
R8289:Ide UTSW 19 37313553 missense
R8289:Ide UTSW 19 37313554 missense probably null
R8359:Ide UTSW 19 37330487 missense
Z1176:Ide UTSW 19 37315491 missense
Predicted Primers PCR Primer
(F):5'- GATGCTGCCCAAAGACACTTAC -3'
(R):5'- AAAGCAGCCTTAGGATCTGGG -3'

Sequencing Primer
(F):5'- CCCTTTGATTTGAGTTCTGACAACAG -3'
(R):5'- GCAGCTGATTAGCCAAAGT -3'
Posted On2016-10-26