Incidental Mutation 'R5601:Asmt'
ID439052
Institutional Source Beutler Lab
Gene Symbol Asmt
Ensembl Gene ENSMUSG00000093806
Gene Nameacetylserotonin O-methyltransferase
SynonymsHiomt
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5601 (G1)
Quality Score191
Status Not validated
ChromosomeX
Chromosomal Location170672644-170678054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170676392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 212 (V212A)
Ref Sequence ENSEMBL: ENSMUSP00000137135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178693]
Predicted Effect probably damaging
Transcript: ENSMUST00000178693
AA Change: V212A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137135
Gene: ENSMUSG00000093806
AA Change: V212A

DomainStartEndE-ValueType
Pfam:Dimerisation2 17 106 1.1e-29 PFAM
Pfam:Methyltransf_2 111 343 2.8e-82 PFAM
Pfam:Methyltransf_11 190 292 2.8e-8 PFAM
low complexity region 351 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the methyltransferase superfamily and is located in the pseudoautosomal region (PAR) of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin and is abundant in the pineal gland. Two amino acid substitutions (R78G and R242C) are present in the encoded protein derived from the reference strain, C57BL/6J, and this protein shows low enzyme activity relative to the protein derived from other strains. [provided by RefSeq, May 2015]
PHENOTYPE: Pineal melatonin synthesis requires enzymes encoded by Asmt and Aanat. C57BL/6, BALB/c, AKR/J, NZB/Bl, IS/Cam, and CAST/Ei carry the a allele of Asmt and lack melatonin. SK/Cam, SF/Cam, PERU, and FDS carry the b allele and have normal melatonin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Asmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1634:Asmt UTSW X 170675829 missense probably damaging 1.00
R1809:Asmt UTSW X 170675745 splice site probably benign
R1994:Asmt UTSW X 170675789 missense possibly damaging 0.83
R4454:Asmt UTSW X 170672721 missense probably benign 0.01
R4546:Asmt UTSW X 170676495 critical splice donor site probably null
R4567:Asmt UTSW X 170676526 intron probably null
R4889:Asmt UTSW X 170677029 missense possibly damaging 0.84
R5687:Asmt UTSW X 170678016 missense unknown
R6145:Asmt UTSW X 170674663 missense probably damaging 0.96
R6151:Asmt UTSW X 170676467 missense possibly damaging 0.92
R6582:Asmt UTSW X 170675031 critical splice donor site probably null
R6752:Asmt UTSW X 170676361 missense probably benign 0.02
R7737:Asmt UTSW X 170676440 missense probably damaging 0.98
R8272:Asmt UTSW X 170672725 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAGGGTTCAGGAAGTGACATC -3'
(R):5'- ACTTGAAGTTGTGGCCAGGG -3'

Sequencing Primer
(F):5'- CACTCCAAGCTTCATAACAGGATGTG -3'
(R):5'- TGATTGAAGGCCCGGGATG -3'
Posted On2016-10-26