Incidental Mutation 'R5602:Ggt7'
ID439063
Institutional Source Beutler Lab
Gene Symbol Ggt7
Ensembl Gene ENSMUSG00000027603
Gene Namegamma-glutamyltransferase 7
Synonyms1110017C11Rik, 6330563L03Rik, Ggtl3
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R5602 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155490379-155518237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155490999 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 648 (V648A)
Ref Sequence ENSEMBL: ENSMUSP00000029131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029131]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029131
AA Change: V648A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029131
Gene: ENSMUSG00000027603
AA Change: V648A

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 655 1.4e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148296
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a gene family that encodes enzymes involved in both the metabolism of glutathione and in the transpeptidation of amino acids. Changes in the activity of gamma-glutamyltransferase may signal preneoplastic or toxic conditions in the liver or kidney. The protein encoded by this gene consists of a heavy and a light chain, and it can interact with CT120, a plasma membrane-associated protein that is possibly involved in lung carcinogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Ggt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ggt7 APN 2 155500771 missense probably damaging 0.99
IGL02523:Ggt7 APN 2 155514703 missense probably damaging 1.00
IGL02999:Ggt7 APN 2 155502713 missense probably benign 0.00
R0030:Ggt7 UTSW 2 155506488 missense probably benign 0.00
R0038:Ggt7 UTSW 2 155502781 missense probably benign 0.08
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0683:Ggt7 UTSW 2 155506508 missense probably benign 0.08
R1035:Ggt7 UTSW 2 155506427 missense probably damaging 1.00
R1500:Ggt7 UTSW 2 155499046 missense probably benign 0.00
R1633:Ggt7 UTSW 2 155502688 missense probably damaging 1.00
R1693:Ggt7 UTSW 2 155506475 missense probably damaging 0.99
R1696:Ggt7 UTSW 2 155494979 missense possibly damaging 0.89
R1879:Ggt7 UTSW 2 155514787 missense possibly damaging 0.91
R2219:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R2220:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R4010:Ggt7 UTSW 2 155500732 missense probably benign 0.00
R5680:Ggt7 UTSW 2 155506433 missense probably damaging 1.00
R6092:Ggt7 UTSW 2 155518039 critical splice donor site probably null
R6440:Ggt7 UTSW 2 155498811 missense probably damaging 1.00
R6989:Ggt7 UTSW 2 155503460 missense probably benign 0.25
R7050:Ggt7 UTSW 2 155506375 missense probably benign 0.10
R7058:Ggt7 UTSW 2 155503095 intron probably null
R7395:Ggt7 UTSW 2 155495880 missense probably benign 0.26
R7768:Ggt7 UTSW 2 155506501 missense possibly damaging 0.60
X0065:Ggt7 UTSW 2 155495695 missense probably benign 0.37
Z1176:Ggt7 UTSW 2 155491078 missense probably damaging 0.99
Z1176:Ggt7 UTSW 2 155499063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCATCATTCCCACCAAAGG -3'
(R):5'- TAAGGTCCCTGAGTCAGCAC -3'

Sequencing Primer
(F):5'- GATAGGGTTTGCTAAGCATCCCC -3'
(R):5'- GAGTCAGCACTCTAACGCATGTATG -3'
Posted On2016-10-26