Incidental Mutation 'R5602:Col15a1'
ID 439065
Institutional Source Beutler Lab
Gene Symbol Col15a1
Ensembl Gene ENSMUSG00000028339
Gene Name collagen, type XV, alpha 1
Synonyms
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 47208161-47313167 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47312087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1301 (V1301M)
Ref Sequence ENSEMBL: ENSMUSP00000099981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917] [ENSMUST00000107730] [ENSMUST00000107731]
AlphaFold O35206
PDB Structure MURINE COLLAGEN ALPHA1(XV), ENDOSTATIN DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000082303
AA Change: V1279M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339
AA Change: V1279M

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 663 1.4e-10 PFAM
Pfam:Collagen 650 719 2.1e-9 PFAM
low complexity region 722 742 N/A INTRINSIC
low complexity region 750 759 N/A INTRINSIC
Pfam:Collagen 782 832 2.7e-10 PFAM
Pfam:Collagen 838 894 5.1e-10 PFAM
low complexity region 965 980 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
Pfam:Endostatin 1087 1164 9.3e-15 PFAM
Pfam:Endostatin 1148 1345 1.4e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102917
AA Change: V1301M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339
AA Change: V1301M

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 666 5.6e-10 PFAM
Pfam:Collagen 659 720 3.1e-10 PFAM
low complexity region 737 764 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
Pfam:Collagen 804 854 9.5e-10 PFAM
Pfam:Collagen 860 916 1.8e-9 PFAM
low complexity region 987 1002 N/A INTRINSIC
low complexity region 1032 1042 N/A INTRINSIC
low complexity region 1050 1109 N/A INTRINSIC
Pfam:Endostatin 1112 1362 2.8e-102 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107730
AA Change: V212M

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103358
Gene: ENSMUSG00000028339
AA Change: V212M

DomainStartEndE-ValueType
Pfam:Endostatin 20 100 8.7e-16 PFAM
Pfam:Endostatin 83 278 5.7e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107731
AA Change: V467M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103359
Gene: ENSMUSG00000028339
AA Change: V467M

DomainStartEndE-ValueType
Pfam:Collagen 6 81 6.5e-9 PFAM
Pfam:Collagen 48 102 3.8e-8 PFAM
low complexity region 153 168 N/A INTRINSIC
Pfam:Collagen 196 258 4.1e-8 PFAM
Pfam:Endostatin 275 355 2.5e-15 PFAM
Pfam:Endostatin 336 533 2.8e-98 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Col15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Col15a1 APN 4 47208450 missense possibly damaging 0.86
IGL01561:Col15a1 APN 4 47312118 missense possibly damaging 0.87
IGL01750:Col15a1 APN 4 47303897 missense probably damaging 1.00
IGL02112:Col15a1 APN 4 47253985 splice site probably benign
IGL02158:Col15a1 APN 4 47300606 splice site probably null
IGL02268:Col15a1 APN 4 47245380 missense probably damaging 0.99
IGL02325:Col15a1 APN 4 47289364 missense probably damaging 1.00
IGL02583:Col15a1 APN 4 47279866 missense probably benign 0.00
IGL02699:Col15a1 APN 4 47284471 unclassified probably benign
IGL03167:Col15a1 APN 4 47282635 missense probably damaging 0.99
IGL03174:Col15a1 APN 4 47282666 missense probably damaging 0.99
R0119:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0299:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0499:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0567:Col15a1 UTSW 4 47293231 missense possibly damaging 0.89
R0607:Col15a1 UTSW 4 47282654 missense probably damaging 0.99
R0992:Col15a1 UTSW 4 47300491 missense probably damaging 0.96
R1165:Col15a1 UTSW 4 47257275 splice site probably benign
R1191:Col15a1 UTSW 4 47254083 nonsense probably null
R1852:Col15a1 UTSW 4 47299278 critical splice donor site probably null
R2349:Col15a1 UTSW 4 47306742 missense probably damaging 0.99
R2512:Col15a1 UTSW 4 47245868 missense possibly damaging 0.95
R2517:Col15a1 UTSW 4 47208492 missense probably damaging 0.98
R2895:Col15a1 UTSW 4 47312091 missense possibly damaging 0.59
R3688:Col15a1 UTSW 4 47258689 missense probably benign 0.00
R3848:Col15a1 UTSW 4 47289374 missense possibly damaging 0.73
R4430:Col15a1 UTSW 4 47245705 missense probably damaging 1.00
R4587:Col15a1 UTSW 4 47257184 missense probably damaging 1.00
R4793:Col15a1 UTSW 4 47262997 missense possibly damaging 0.83
R4812:Col15a1 UTSW 4 47262479 missense possibly damaging 0.93
R4922:Col15a1 UTSW 4 47258719 missense probably benign
R5233:Col15a1 UTSW 4 47296112 missense possibly damaging 0.74
R5786:Col15a1 UTSW 4 47280865 missense possibly damaging 0.84
R5910:Col15a1 UTSW 4 47289514 missense probably damaging 1.00
R5921:Col15a1 UTSW 4 47300602 missense probably damaging 0.99
R5974:Col15a1 UTSW 4 47258683 missense probably benign 0.02
R5985:Col15a1 UTSW 4 47284507 missense probably damaging 0.99
R6010:Col15a1 UTSW 4 47245630 missense probably benign 0.03
R6720:Col15a1 UTSW 4 47247552 critical splice donor site probably null
R6791:Col15a1 UTSW 4 47300518 missense probably damaging 1.00
R6855:Col15a1 UTSW 4 47245544 missense probably damaging 1.00
R6965:Col15a1 UTSW 4 47247533 missense probably damaging 0.96
R7201:Col15a1 UTSW 4 47307752 missense possibly damaging 0.92
R7261:Col15a1 UTSW 4 47269088 missense probably benign 0.03
R7273:Col15a1 UTSW 4 47284467 splice site probably null
R7413:Col15a1 UTSW 4 47245431 missense possibly damaging 0.81
R7658:Col15a1 UTSW 4 47245591 missense possibly damaging 0.46
R8032:Col15a1 UTSW 4 47288108 missense unknown
R8075:Col15a1 UTSW 4 47208359 missense probably benign 0.07
R8130:Col15a1 UTSW 4 47312196 missense probably damaging 0.97
R8536:Col15a1 UTSW 4 47208536 critical splice donor site probably null
R8873:Col15a1 UTSW 4 47247552 critical splice donor site probably null
R8887:Col15a1 UTSW 4 47287091 missense probably damaging 1.00
R9141:Col15a1 UTSW 4 47288200 unclassified probably benign
R9143:Col15a1 UTSW 4 47288200 unclassified probably benign
R9161:Col15a1 UTSW 4 47288200 unclassified probably benign
R9176:Col15a1 UTSW 4 47288200 unclassified probably benign
R9177:Col15a1 UTSW 4 47288200 unclassified probably benign
R9181:Col15a1 UTSW 4 47288200 unclassified probably benign
R9184:Col15a1 UTSW 4 47288200 unclassified probably benign
R9185:Col15a1 UTSW 4 47288200 unclassified probably benign
R9214:Col15a1 UTSW 4 47288200 unclassified probably benign
R9268:Col15a1 UTSW 4 47288200 unclassified probably benign
R9269:Col15a1 UTSW 4 47288200 unclassified probably benign
R9362:Col15a1 UTSW 4 47288200 unclassified probably benign
R9367:Col15a1 UTSW 4 47245603 missense probably damaging 1.00
R9385:Col15a1 UTSW 4 47300473 nonsense probably null
R9391:Col15a1 UTSW 4 47288200 unclassified probably benign
R9392:Col15a1 UTSW 4 47288200 unclassified probably benign
R9419:Col15a1 UTSW 4 47288200 unclassified probably benign
R9421:Col15a1 UTSW 4 47288200 unclassified probably benign
R9422:Col15a1 UTSW 4 47293364 critical splice acceptor site probably null
R9426:Col15a1 UTSW 4 47288200 unclassified probably benign
R9427:Col15a1 UTSW 4 47288200 unclassified probably benign
R9429:Col15a1 UTSW 4 47310439 missense probably damaging 1.00
Z1177:Col15a1 UTSW 4 47245807 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAACATGTCTCTCCCTTTG -3'
(R):5'- TGCACAGCACGATTAGCCTG -3'

Sequencing Primer
(F):5'- ATCACTTATCTCATAGCCAGGTGGG -3'
(R):5'- AGCACGATTAGCCTGTTAGC -3'
Posted On 2016-10-26