Incidental Mutation 'R5602:Gpr3'
ID 439066
Institutional Source Beutler Lab
Gene Symbol Gpr3
Ensembl Gene ENSMUSG00000049649
Gene Name G-protein coupled receptor 3
Synonyms Gpcr3, Gpcr21
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 133209340-133212536 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133210494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 289 (N289S)
Ref Sequence ENSEMBL: ENSMUSP00000101531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052090] [ENSMUST00000105911] [ENSMUST00000151025]
AlphaFold P35413
Predicted Effect probably damaging
Transcript: ENSMUST00000052090
AA Change: N289S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062083
Gene: ENSMUSG00000049649
AA Change: N289S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:7tm_1 57 297 2.4e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105911
AA Change: N289S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101531
Gene: ENSMUSG00000049649
AA Change: N289S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:7tm_1 57 297 2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150744
Predicted Effect probably benign
Transcript: ENSMUST00000151025
SMART Domains Protein: ENSMUSP00000116032
Gene: ENSMUSG00000049649

DomainStartEndE-ValueType
SCOP:d1l9ha_ 20 95 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218998
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family and is found in the cell membrane. G protein-coupled receptors, characterized by a seven transmembrane domain motif, are involved in translating outside signals into G protein mediated intracellular effects. The encoded protein activates adenylate cyclase and modulates amyloid-beta production in a mouse model, suggesting that it may play a role in Alzheimer's disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for one allele display an increased thermal nociceptive threshold while females homozygous for another allele display age-related reproductive failure due to ovulation of a progressively increasing proportion of developmentally incompetent oocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Gpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02424:Gpr3 APN 4 133211094 missense probably damaging 1.00
IGL02974:Gpr3 APN 4 133210909 missense possibly damaging 0.90
R0095:Gpr3 UTSW 4 133211286 missense probably benign 0.01
R0532:Gpr3 UTSW 4 133210485 missense probably damaging 1.00
R1831:Gpr3 UTSW 4 133211143 missense possibly damaging 0.80
R2127:Gpr3 UTSW 4 133210621 missense probably damaging 0.96
R4077:Gpr3 UTSW 4 133210915 missense probably damaging 1.00
R4078:Gpr3 UTSW 4 133210915 missense probably damaging 1.00
R5306:Gpr3 UTSW 4 133211179 missense probably damaging 1.00
R5712:Gpr3 UTSW 4 133210408 missense probably benign 0.01
R5913:Gpr3 UTSW 4 133211178 missense probably damaging 1.00
R7434:Gpr3 UTSW 4 133211137 missense probably benign 0.45
R7645:Gpr3 UTSW 4 133211329 missense probably damaging 1.00
R7709:Gpr3 UTSW 4 133210437 missense probably damaging 1.00
R8043:Gpr3 UTSW 4 133210960 missense probably damaging 1.00
R8818:Gpr3 UTSW 4 133211227 missense possibly damaging 0.95
R9015:Gpr3 UTSW 4 133211079 missense possibly damaging 0.80
R9027:Gpr3 UTSW 4 133210898 nonsense probably null
R9587:Gpr3 UTSW 4 133210677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTGGACCTAACACTCTG -3'
(R):5'- AGCTCTATGCCCAGATCTGC -3'

Sequencing Primer
(F):5'- GTGGACCTAACACTCTGGAGTTC -3'
(R):5'- AGATCTGCCGCATCGTCTG -3'
Posted On 2016-10-26