Incidental Mutation 'R5602:Pdik1l'
ID 439067
Institutional Source Beutler Lab
Gene Symbol Pdik1l
Ensembl Gene ENSMUSG00000050890
Gene Name PDLIM1 interacting kinase 1 like
Synonyms
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 134275002-134287895 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134284269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 164 (S164P)
Ref Sequence ENSEMBL: ENSMUSP00000101503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061234] [ENSMUST00000105876] [ENSMUST00000105877] [ENSMUST00000127857] [ENSMUST00000145006]
AlphaFold Q8QZR7
Predicted Effect probably damaging
Transcript: ENSMUST00000061234
AA Change: S88P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060381
Gene: ENSMUSG00000050890
AA Change: S88P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105876
AA Change: S88P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101502
Gene: ENSMUSG00000050890
AA Change: S88P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105877
AA Change: S164P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101503
Gene: ENSMUSG00000050890
AA Change: S164P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 84 184 2.2e-7 PFAM
Pfam:Pkinase 84 402 4.5e-51 PFAM
Pfam:Pkinase_Tyr 185 405 6.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127857
AA Change: S88P

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117719
Gene: ENSMUSG00000050890
AA Change: S88P

DomainStartEndE-ValueType
Pfam:Pkinase 8 113 3.4e-12 PFAM
Pfam:Pkinase_Tyr 8 136 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142504
Predicted Effect probably benign
Transcript: ENSMUST00000145006
SMART Domains Protein: ENSMUSP00000118116
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 185 4.1e-24 PFAM
Pfam:Pkinase 10 187 4.9e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Pdik1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Pdik1l APN 4 134278704 missense probably benign 0.11
FR4304:Pdik1l UTSW 4 134279374 frame shift probably null
FR4340:Pdik1l UTSW 4 134279512 intron probably benign
FR4342:Pdik1l UTSW 4 134279509 intron probably benign
FR4548:Pdik1l UTSW 4 134279512 intron probably benign
FR4589:Pdik1l UTSW 4 134279368 frame shift probably null
FR4589:Pdik1l UTSW 4 134279369 frame shift probably null
FR4737:Pdik1l UTSW 4 134279367 frame shift probably null
FR4737:Pdik1l UTSW 4 134279506 intron probably benign
FR4976:Pdik1l UTSW 4 134279506 intron probably benign
R1867:Pdik1l UTSW 4 134278911 missense probably damaging 1.00
R2106:Pdik1l UTSW 4 134284254 missense probably damaging 1.00
R2303:Pdik1l UTSW 4 134284248 nonsense probably null
R2398:Pdik1l UTSW 4 134278399 missense probably benign 0.01
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R4515:Pdik1l UTSW 4 134278896 missense probably damaging 1.00
R4711:Pdik1l UTSW 4 134278990 missense probably benign 0.15
R5822:Pdik1l UTSW 4 134287163 missense possibly damaging 0.53
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R7517:Pdik1l UTSW 4 134278425 missense possibly damaging 0.83
R7705:Pdik1l UTSW 4 134279493 missense unknown
R8203:Pdik1l UTSW 4 134279365 missense unknown
R8524:Pdik1l UTSW 4 134286610 missense probably benign
RF002:Pdik1l UTSW 4 134279375 frame shift probably null
RF007:Pdik1l UTSW 4 134279368 frame shift probably null
RF008:Pdik1l UTSW 4 134279511 intron probably benign
RF022:Pdik1l UTSW 4 134279367 frame shift probably null
RF025:Pdik1l UTSW 4 134286594 frame shift probably null
RF026:Pdik1l UTSW 4 134286594 intron probably benign
RF030:Pdik1l UTSW 4 134279516 intron probably benign
RF031:Pdik1l UTSW 4 134279374 frame shift probably null
RF034:Pdik1l UTSW 4 134279374 frame shift probably null
RF035:Pdik1l UTSW 4 134279510 intron probably benign
RF040:Pdik1l UTSW 4 134279515 intron probably benign
RF048:Pdik1l UTSW 4 134279372 frame shift probably null
RF056:Pdik1l UTSW 4 134279502 intron probably benign
RF056:Pdik1l UTSW 4 134279516 intron probably benign
RF057:Pdik1l UTSW 4 134279368 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTACCAGGCATAGCAGGTG -3'
(R):5'- AAGACCTCTGCGAGAGTAGC -3'

Sequencing Primer
(F):5'- AGCACAAGTTTAAGGCAGACAC -3'
(R):5'- CCGTGAAGAAAATTCGATGCC -3'
Posted On 2016-10-26