Incidental Mutation 'R5602:Cnot4'
ID439072
Institutional Source Beutler Lab
Gene Symbol Cnot4
Ensembl Gene ENSMUSG00000038784
Gene NameCCR4-NOT transcription complex, subunit 4
SynonymsNot4h, Not4, Not4hp
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5602 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location35022065-35133724 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 35051529 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 384 (W384*)
Ref Sequence ENSEMBL: ENSMUSP00000144409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044163] [ENSMUST00000114989] [ENSMUST00000114993] [ENSMUST00000202143] [ENSMUST00000202417]
Predicted Effect probably null
Transcript: ENSMUST00000044163
AA Change: W387*
SMART Domains Protein: ENSMUSP00000044137
Gene: ENSMUSG00000038784
AA Change: W387*

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114989
AA Change: W387*
SMART Domains Protein: ENSMUSP00000110640
Gene: ENSMUSG00000038784
AA Change: W387*

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
low complexity region 537 549 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114993
AA Change: W384*
SMART Domains Protein: ENSMUSP00000110645
Gene: ENSMUSG00000038784
AA Change: W384*

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
low complexity region 572 592 N/A INTRINSIC
low complexity region 644 658 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200743
Predicted Effect probably null
Transcript: ENSMUST00000202143
AA Change: W384*
SMART Domains Protein: ENSMUSP00000144352
Gene: ENSMUSG00000038784
AA Change: W384*

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
low complexity region 534 546 N/A INTRINSIC
low complexity region 573 587 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202417
AA Change: W384*
SMART Domains Protein: ENSMUSP00000144409
Gene: ENSMUSG00000038784
AA Change: W384*

DomainStartEndE-ValueType
RING 14 56 4.14e-1 SMART
low complexity region 76 93 N/A INTRINSIC
RRM 110 189 6.41e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202666
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the CCR4-NOT complex, a global transcriptional regulator. The encoded protein interacts with CNOT1 and has E3 ubiquitin ligase activity. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Cnot4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Cnot4 APN 6 35078114 missense probably damaging 1.00
IGL01341:Cnot4 APN 6 35070254 missense probably damaging 1.00
IGL01346:Cnot4 APN 6 35070248 missense probably damaging 1.00
IGL01775:Cnot4 APN 6 35069476 splice site probably benign
IGL02035:Cnot4 APN 6 35070251 missense probably damaging 1.00
IGL02167:Cnot4 APN 6 35056224 missense possibly damaging 0.49
IGL02227:Cnot4 APN 6 35051263 missense probably benign 0.44
IGL03136:Cnot4 APN 6 35051241 missense probably damaging 0.99
IGL03230:Cnot4 APN 6 35051409 missense probably damaging 1.00
IGL03297:Cnot4 APN 6 35024223 missense probably benign
R0049:Cnot4 UTSW 6 35051277 missense probably benign
R0049:Cnot4 UTSW 6 35051277 missense probably benign
R0597:Cnot4 UTSW 6 35051503 missense possibly damaging 0.66
R1518:Cnot4 UTSW 6 35051454 missense probably damaging 0.98
R1883:Cnot4 UTSW 6 35078157 missense probably damaging 0.99
R1884:Cnot4 UTSW 6 35078157 missense probably damaging 0.99
R1992:Cnot4 UTSW 6 35023409 missense probably benign
R3500:Cnot4 UTSW 6 35080141 start gained probably benign
R4738:Cnot4 UTSW 6 35051376 missense probably benign 0.28
R5029:Cnot4 UTSW 6 35078027 missense probably damaging 1.00
R5247:Cnot4 UTSW 6 35051416 missense probably damaging 0.96
R5534:Cnot4 UTSW 6 35078004 missense possibly damaging 0.55
R6236:Cnot4 UTSW 6 35068673 missense probably benign 0.33
R6701:Cnot4 UTSW 6 35068604 missense probably damaging 1.00
R7252:Cnot4 UTSW 6 35069427 missense probably damaging 1.00
R7360:Cnot4 UTSW 6 35065006 missense probably damaging 1.00
R7479:Cnot4 UTSW 6 35024148 missense probably benign 0.00
R7574:Cnot4 UTSW 6 35053004 missense possibly damaging 0.82
R8063:Cnot4 UTSW 6 35068643 missense probably damaging 0.98
R8137:Cnot4 UTSW 6 35046287 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGTAGGTGCAGCAGAGTGC -3'
(R):5'- CTACTAGAAATTGATGAGGTCCTCTG -3'

Sequencing Primer
(F):5'- TGCAGGAATCCAGAGCCTG -3'
(R):5'- GGTCCTCTGGAACTAATGATCTTAAC -3'
Posted On2016-10-26