Incidental Mutation 'R5602:Washc2'
ID 439073
Institutional Source Beutler Lab
Gene Symbol Washc2
Ensembl Gene ENSMUSG00000024104
Gene Name WASH complex subunit 2`
Synonyms Fam21, D6Wsu116e, C530005J20Rik
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 116208038-116262686 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116248095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 801 (D801E)
Ref Sequence ENSEMBL: ENSMUSP00000144982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036759] [ENSMUST00000204283] [ENSMUST00000204476]
AlphaFold Q6PGL7
Predicted Effect probably benign
Transcript: ENSMUST00000036759
AA Change: D801E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038983
Gene: ENSMUSG00000024104
AA Change: D801E

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:CAP-ZIP_m 939 1074 4.3e-58 PFAM
low complexity region 1268 1282 N/A INTRINSIC
low complexity region 1297 1317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203802
Predicted Effect probably benign
Transcript: ENSMUST00000204283
AA Change: D715E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144703
Gene: ENSMUSG00000024104
AA Change: D715E

DomainStartEndE-ValueType
coiled coil region 9 43 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 130 152 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
low complexity region 357 369 N/A INTRINSIC
low complexity region 445 475 N/A INTRINSIC
low complexity region 574 582 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
Pfam:CAP-ZIP_m 853 988 2.8e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204476
AA Change: D801E

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144982
Gene: ENSMUSG00000024104
AA Change: D801E

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Washc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Washc2 APN 6 116256676 missense probably benign
IGL00552:Washc2 APN 6 116256824 missense possibly damaging 0.85
IGL01397:Washc2 APN 6 116247998 missense probably benign 0.44
IGL01668:Washc2 APN 6 116262338 missense probably damaging 1.00
IGL01982:Washc2 APN 6 116236189 missense probably benign 0.22
IGL02022:Washc2 APN 6 116259165 missense probably benign 0.22
IGL02150:Washc2 APN 6 116231632 splice site probably benign
IGL02224:Washc2 APN 6 116220569 missense possibly damaging 0.70
IGL02553:Washc2 APN 6 116241610 missense probably damaging 0.98
IGL02555:Washc2 APN 6 116209100 missense probably damaging 1.00
IGL02612:Washc2 APN 6 116220616 missense possibly damaging 0.90
IGL02622:Washc2 APN 6 116214018 splice site probably benign
IGL02900:Washc2 APN 6 116227474 missense probably damaging 1.00
IGL03263:Washc2 APN 6 116238123 splice site probably benign
fading UTSW 6 116254153 missense probably damaging 1.00
R0218:Washc2 UTSW 6 116248046 nonsense probably null
R0285:Washc2 UTSW 6 116221839 missense probably damaging 1.00
R0346:Washc2 UTSW 6 116220523 splice site probably benign
R0677:Washc2 UTSW 6 116244616 missense probably damaging 1.00
R0919:Washc2 UTSW 6 116208264 missense probably damaging 1.00
R1144:Washc2 UTSW 6 116224534 missense probably damaging 1.00
R1666:Washc2 UTSW 6 116223254 critical splice donor site probably null
R1687:Washc2 UTSW 6 116256712 missense probably benign 0.06
R1702:Washc2 UTSW 6 116229306 missense probably damaging 0.99
R1740:Washc2 UTSW 6 116231632 splice site probably benign
R1952:Washc2 UTSW 6 116255091 missense possibly damaging 0.92
R1964:Washc2 UTSW 6 116208987 missense probably damaging 0.99
R2039:Washc2 UTSW 6 116224439 missense probably damaging 0.99
R3084:Washc2 UTSW 6 116227493 missense probably benign 0.00
R3552:Washc2 UTSW 6 116220568 missense probably damaging 1.00
R3790:Washc2 UTSW 6 116247972 splice site probably benign
R3949:Washc2 UTSW 6 116208204 utr 5 prime probably benign
R4089:Washc2 UTSW 6 116256292 splice site probably null
R4133:Washc2 UTSW 6 116258930 missense probably damaging 0.99
R4258:Washc2 UTSW 6 116208241 missense probably damaging 1.00
R4510:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4511:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4613:Washc2 UTSW 6 116229269 missense probably damaging 1.00
R4614:Washc2 UTSW 6 116238174 missense possibly damaging 0.83
R4794:Washc2 UTSW 6 116258649 missense probably benign 0.03
R5224:Washc2 UTSW 6 116209004 makesense probably null
R5367:Washc2 UTSW 6 116259150 missense probably damaging 1.00
R6013:Washc2 UTSW 6 116254153 missense probably damaging 1.00
R6075:Washc2 UTSW 6 116227366 missense probably benign 0.02
R6086:Washc2 UTSW 6 116256216 splice site probably null
R6344:Washc2 UTSW 6 116258758 missense probably benign 0.08
R6593:Washc2 UTSW 6 116259249 missense probably damaging 1.00
R7048:Washc2 UTSW 6 116220583 missense possibly damaging 0.96
R7062:Washc2 UTSW 6 116219988 missense possibly damaging 0.72
R7241:Washc2 UTSW 6 116208207 start codon destroyed probably null 0.01
R7283:Washc2 UTSW 6 116227418 missense probably damaging 0.99
R7681:Washc2 UTSW 6 116260657 missense probably damaging 0.99
R7810:Washc2 UTSW 6 116259059 missense probably benign
R7908:Washc2 UTSW 6 116248145 missense probably benign
R7923:Washc2 UTSW 6 116226424 missense possibly damaging 0.83
R8067:Washc2 UTSW 6 116224503 missense probably damaging 0.99
R8697:Washc2 UTSW 6 116229259 missense probably benign 0.17
R8841:Washc2 UTSW 6 116258955 missense probably benign 0.16
R8920:Washc2 UTSW 6 116244654 missense possibly damaging 0.92
R8971:Washc2 UTSW 6 116254438 missense probably damaging 0.99
R9010:Washc2 UTSW 6 116221862 missense probably damaging 1.00
R9231:Washc2 UTSW 6 116258938 missense probably benign 0.05
R9257:Washc2 UTSW 6 116216108 nonsense probably null
R9361:Washc2 UTSW 6 116262472 makesense probably null
R9571:Washc2 UTSW 6 116260670 critical splice donor site unknown
X0018:Washc2 UTSW 6 116208258 missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- TTGTCAAGCTTGTGAAGACCC -3'
(R):5'- TAAAAGCTCAGACTTCCTCAGGC -3'

Sequencing Primer
(F):5'- TCAAGCTTGTGAAGACCCCATGG -3'
(R):5'- AGACTTCCTCAGGCCTCAG -3'
Posted On 2016-10-26