Mutagenetix > Incidental Mutation

Incidental Mutation 'R5602:Washc2'

439073

Institutional Source

Beutler Lab

Gene Symbol

Washc2

Ensembl Gene

ENSMUSG00000024104

Gene Name

WASH complex subunit 2`

Synonyms

Fam21, D6Wsu116e, C530005J20Rik

MMRRC Submission

043154-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5602 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116208038-116262686 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116248095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 801 (D801E)

Ref Sequence

ENSEMBL: ENSMUSP00000144982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036759] [ENSMUST00000204283] [ENSMUST00000204476]

AlphaFold

Q6PGL7

Predicted Effect

probably benign
Transcript: ENSMUST00000036759
AA Change: D801E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000038983
Gene: ENSMUSG00000024104
AA Change: D801E

Domain	Start	End	E-Value	Type
coiled coil region	95	129	N/A	INTRINSIC
low complexity region	196	213	N/A	INTRINSIC
low complexity region	216	238	N/A	INTRINSIC
low complexity region	262	276	N/A	INTRINSIC
low complexity region	443	455	N/A	INTRINSIC
low complexity region	531	561	N/A	INTRINSIC
low complexity region	660	668	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
Pfam:CAP-ZIP_m	939	1074	4.3e-58	PFAM
low complexity region	1268	1282	N/A	INTRINSIC
low complexity region	1297	1317	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203802

Predicted Effect

probably benign
Transcript: ENSMUST00000204283
AA Change: D715E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000144703
Gene: ENSMUSG00000024104
AA Change: D715E

Domain	Start	End	E-Value	Type
coiled coil region	9	43	N/A	INTRINSIC
low complexity region	110	127	N/A	INTRINSIC
low complexity region	130	152	N/A	INTRINSIC
low complexity region	176	190	N/A	INTRINSIC
low complexity region	357	369	N/A	INTRINSIC
low complexity region	445	475	N/A	INTRINSIC
low complexity region	574	582	N/A	INTRINSIC
low complexity region	715	724	N/A	INTRINSIC
Pfam:CAP-ZIP_m	853	988	2.8e-55	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204476
AA Change: D801E

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000144982
Gene: ENSMUSG00000024104
AA Change: D801E

Domain	Start	End	E-Value	Type
coiled coil region	95	129	N/A	INTRINSIC
low complexity region	196	213	N/A	INTRINSIC
low complexity region	216	238	N/A	INTRINSIC
low complexity region	262	276	N/A	INTRINSIC
low complexity region	443	455	N/A	INTRINSIC
low complexity region	531	561	N/A	INTRINSIC
low complexity region	660	668	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	G	A	9: 92,352,668	C152Y	possibly damaging	Het
4921509C19Rik	G	A	2: 151,473,539	S73F	possibly damaging	Het
4932414N04Rik	A	T	2: 68,748,368	*753L	probably null	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adam19	T	C	11: 46,136,315	S592P	probably benign	Het
Adamtsl3	A	G	7: 82,557,239	K843R	possibly damaging	Het
Ap2a2	A	T	7: 141,604,942	T213S	probably benign	Het
Asb5	A	G	8: 54,585,939	E280G	probably benign	Het
Becn1	T	C	11: 101,288,952	D403G	probably damaging	Het
Ccr7	G	T	11: 99,145,489	N202K	probably benign	Het
Cd36	T	C	5: 17,814,792	T104A	possibly damaging	Het
Cnot4	C	T	6: 35,051,529	W384*	probably null	Het
Col15a1	G	A	4: 47,312,087	V1301M	probably damaging	Het
Dock2	C	A	11: 34,254,391	A1384S	probably benign	Het
Ehbp1l1	T	C	19: 5,708,670	E1648G	possibly damaging	Het
Fbn1	G	T	2: 125,321,741	A2065E	possibly damaging	Het
Fras1	A	G	5: 96,737,021	Y2586C	probably damaging	Het
Galm	T	A	17: 80,150,139	Y28*	probably null	Het
Ggt7	A	G	2: 155,490,999	V648A	possibly damaging	Het
Gm17067	T	A	7: 42,708,415	D221V	probably damaging	Het
Gpr3	T	C	4: 133,210,494	N289S	probably damaging	Het
Ighv11-2	G	A	12: 114,048,479	L39F	probably damaging	Het
Ighv11-2	A	G	12: 114,048,657		probably benign	Het
Ipo9	G	A	1: 135,402,245	L486F	probably damaging	Het
Jak2	T	A	19: 29,298,339	N726K	probably benign	Het
Map4	T	C	9: 110,052,700	S211P	possibly damaging	Het
Mlh1	A	T	9: 111,252,878	L259Q	probably damaging	Het
Naa25	A	G	5: 121,420,495	E300G	probably benign	Het
Olfr954	A	T	9: 39,462,030	M200L	probably benign	Het
Olfr969	T	A	9: 39,796,194	V273E	possibly damaging	Het
Parva	G	A	7: 112,567,765	V182I	probably benign	Het
Pcdhgb4	T	C	18: 37,721,644	I364T	probably damaging	Het
Pdik1l	A	G	4: 134,284,269	S164P	probably damaging	Het
Pfas	A	T	11: 68,991,045	I938N	probably benign	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Prob1	C	T	18: 35,654,026	V392M	possibly damaging	Het
Rasgrf1	T	C	9: 89,911,571	S134P	possibly damaging	Het
Rorb	T	A	19: 18,977,937	Y20F	probably damaging	Het
Rsph9	G	T	17: 46,134,983	D220E	probably damaging	Het
Safb2	C	A	17: 56,575,630	K334N	possibly damaging	Het
Sall3	T	C	18: 80,972,812	T634A	probably benign	Het
Scaf1	A	G	7: 45,007,583		probably benign	Het
Slco1a5	T	A	6: 142,275,529		probably benign	Het
Spata21	C	T	4: 141,096,899	R158C	probably benign	Het
Srrm2	G	A	17: 23,819,337		probably benign	Het
Stk38l	C	A	6: 146,758,500	T10N	probably benign	Het
Supv3l1	G	A	10: 62,430,592	P602S	possibly damaging	Het
Timm44	C	T	8: 4,266,769		probably null	Het
Tll2	T	A	19: 41,104,981	R465S	possibly damaging	Het
Tmem104	G	A	11: 115,205,124	A164T	probably damaging	Het
Tmem151b	A	G	17: 45,545,600	S305P	probably damaging	Het
Utrn	T	C	10: 12,750,095	D114G	probably damaging	Het
Vmn2r109	A	T	17: 20,540,671	M808K	possibly damaging	Het
Xkr4	T	C	1: 3,216,528	I480V	probably benign	Het
Zfp507	G	T	7: 35,776,238	S58*	probably null	Het
Zfp768	T	A	7: 127,344,632	D108V	possibly damaging	Het

Other mutations in Washc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Washc2	APN	6	116256676	missense	probably benign
IGL00552:Washc2	APN	6	116256824	missense	possibly damaging	0.85
IGL01397:Washc2	APN	6	116247998	missense	probably benign	0.44
IGL01668:Washc2	APN	6	116262338	missense	probably damaging	1.00
IGL01982:Washc2	APN	6	116236189	missense	probably benign	0.22
IGL02022:Washc2	APN	6	116259165	missense	probably benign	0.22
IGL02150:Washc2	APN	6	116231632	splice site	probably benign
IGL02224:Washc2	APN	6	116220569	missense	possibly damaging	0.70
IGL02553:Washc2	APN	6	116241610	missense	probably damaging	0.98
IGL02555:Washc2	APN	6	116209100	missense	probably damaging	1.00
IGL02612:Washc2	APN	6	116220616	missense	possibly damaging	0.90
IGL02622:Washc2	APN	6	116214018	splice site	probably benign
IGL02900:Washc2	APN	6	116227474	missense	probably damaging	1.00
IGL03263:Washc2	APN	6	116238123	splice site	probably benign
fading	UTSW	6	116254153	missense	probably damaging	1.00
R0218:Washc2	UTSW	6	116248046	nonsense	probably null
R0285:Washc2	UTSW	6	116221839	missense	probably damaging	1.00
R0346:Washc2	UTSW	6	116220523	splice site	probably benign
R0677:Washc2	UTSW	6	116244616	missense	probably damaging	1.00
R0919:Washc2	UTSW	6	116208264	missense	probably damaging	1.00
R1144:Washc2	UTSW	6	116224534	missense	probably damaging	1.00
R1666:Washc2	UTSW	6	116223254	critical splice donor site	probably null
R1687:Washc2	UTSW	6	116256712	missense	probably benign	0.06
R1702:Washc2	UTSW	6	116229306	missense	probably damaging	0.99
R1740:Washc2	UTSW	6	116231632	splice site	probably benign
R1952:Washc2	UTSW	6	116255091	missense	possibly damaging	0.92
R1964:Washc2	UTSW	6	116208987	missense	probably damaging	0.99
R2039:Washc2	UTSW	6	116224439	missense	probably damaging	0.99
R3084:Washc2	UTSW	6	116227493	missense	probably benign	0.00
R3552:Washc2	UTSW	6	116220568	missense	probably damaging	1.00
R3790:Washc2	UTSW	6	116247972	splice site	probably benign
R3949:Washc2	UTSW	6	116208204	utr 5 prime	probably benign
R4089:Washc2	UTSW	6	116256292	splice site	probably null
R4133:Washc2	UTSW	6	116258930	missense	probably damaging	0.99
R4258:Washc2	UTSW	6	116208241	missense	probably damaging	1.00
R4510:Washc2	UTSW	6	116220556	missense	probably damaging	1.00
R4511:Washc2	UTSW	6	116220556	missense	probably damaging	1.00
R4613:Washc2	UTSW	6	116229269	missense	probably damaging	1.00
R4614:Washc2	UTSW	6	116238174	missense	possibly damaging	0.83
R4794:Washc2	UTSW	6	116258649	missense	probably benign	0.03
R5224:Washc2	UTSW	6	116209004	makesense	probably null
R5367:Washc2	UTSW	6	116259150	missense	probably damaging	1.00
R6013:Washc2	UTSW	6	116254153	missense	probably damaging	1.00
R6075:Washc2	UTSW	6	116227366	missense	probably benign	0.02
R6086:Washc2	UTSW	6	116256216	splice site	probably null
R6344:Washc2	UTSW	6	116258758	missense	probably benign	0.08
R6593:Washc2	UTSW	6	116259249	missense	probably damaging	1.00
R7048:Washc2	UTSW	6	116220583	missense	possibly damaging	0.96
R7062:Washc2	UTSW	6	116219988	missense	possibly damaging	0.72
R7241:Washc2	UTSW	6	116208207	start codon destroyed	probably null	0.01
R7283:Washc2	UTSW	6	116227418	missense	probably damaging	0.99
R7681:Washc2	UTSW	6	116260657	missense	probably damaging	0.99
R7810:Washc2	UTSW	6	116259059	missense	probably benign
R7908:Washc2	UTSW	6	116248145	missense	probably benign
R7923:Washc2	UTSW	6	116226424	missense	possibly damaging	0.83
R8067:Washc2	UTSW	6	116224503	missense	probably damaging	0.99
R8697:Washc2	UTSW	6	116229259	missense	probably benign	0.17
R8841:Washc2	UTSW	6	116258955	missense	probably benign	0.16
R8920:Washc2	UTSW	6	116244654	missense	possibly damaging	0.92
R8971:Washc2	UTSW	6	116254438	missense	probably damaging	0.99
R9010:Washc2	UTSW	6	116221862	missense	probably damaging	1.00
R9231:Washc2	UTSW	6	116258938	missense	probably benign	0.05
R9257:Washc2	UTSW	6	116216108	nonsense	probably null
R9361:Washc2	UTSW	6	116262472	makesense	probably null
R9571:Washc2	UTSW	6	116260670	critical splice donor site	unknown
X0018:Washc2	UTSW	6	116208258	missense	probably null	0.96

Predicted Primers

PCR Primer
(F):5'- TTGTCAAGCTTGTGAAGACCC -3'
(R):5'- TAAAAGCTCAGACTTCCTCAGGC -3'

Sequencing Primer
(F):5'- TCAAGCTTGTGAAGACCCCATGG -3'
(R):5'- AGACTTCCTCAGGCCTCAG -3'

Posted On

2016-10-26