Incidental Mutation 'R5602:Zfp507'
ID 439078
Institutional Source Beutler Lab
Gene Symbol Zfp507
Ensembl Gene ENSMUSG00000044452
Gene Name zinc finger protein 507
Synonyms 1810022O10Rik, A230056M16Rik
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 35772343-35803003 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 35776238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 58 (S58*)
Ref Sequence ENSEMBL: ENSMUSP00000140940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061586] [ENSMUST00000187282] [ENSMUST00000206615]
AlphaFold Q6ZPY5
Predicted Effect probably null
Transcript: ENSMUST00000061586
AA Change: S850*
SMART Domains Protein: ENSMUSP00000058609
Gene: ENSMUSG00000044452
AA Change: S850*

DomainStartEndE-ValueType
ZnF_C2H2 122 144 1.56e-2 SMART
ZnF_C2H2 152 175 2.49e-1 SMART
low complexity region 178 192 N/A INTRINSIC
ZnF_C2H2 237 259 8.52e0 SMART
ZnF_C2H2 630 652 2.75e-3 SMART
ZnF_C2H2 658 680 1.26e-2 SMART
ZnF_C2H2 686 709 5.42e-2 SMART
ZnF_C2H2 746 768 4.79e-3 SMART
ZnF_C2H2 774 796 1.45e-2 SMART
ZnF_C2H2 899 921 3.83e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181078
Predicted Effect probably null
Transcript: ENSMUST00000187282
AA Change: S58*
SMART Domains Protein: ENSMUSP00000140940
Gene: ENSMUSG00000044452
AA Change: S58*

DomainStartEndE-ValueType
ZnF_C2H2 107 129 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206761
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Zfp507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Zfp507 APN 7 35794712 missense possibly damaging 0.93
IGL00835:Zfp507 APN 7 35776038 missense probably damaging 1.00
IGL01083:Zfp507 APN 7 35794038 missense probably benign 0.00
IGL01359:Zfp507 APN 7 35794502 missense probably damaging 1.00
IGL01418:Zfp507 APN 7 35793812 splice site probably null
IGL02122:Zfp507 APN 7 35776095 missense probably damaging 1.00
IGL02506:Zfp507 APN 7 35776466 missense probably damaging 1.00
IGL02601:Zfp507 APN 7 35791711 missense probably damaging 1.00
IGL02643:Zfp507 APN 7 35795231 missense probably damaging 0.99
IGL03129:Zfp507 APN 7 35794206 missense probably damaging 1.00
R0400:Zfp507 UTSW 7 35791746 missense probably damaging 1.00
R0812:Zfp507 UTSW 7 35802623 intron probably benign
R1183:Zfp507 UTSW 7 35794890 missense probably damaging 0.99
R1381:Zfp507 UTSW 7 35776010 missense possibly damaging 0.91
R1542:Zfp507 UTSW 7 35794801 missense possibly damaging 0.71
R1626:Zfp507 UTSW 7 35795433 missense probably damaging 1.00
R1759:Zfp507 UTSW 7 35775978 missense probably damaging 0.99
R1843:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1852:Zfp507 UTSW 7 35787751 missense probably damaging 1.00
R1893:Zfp507 UTSW 7 35802627 intron probably benign
R1923:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1925:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1927:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R2139:Zfp507 UTSW 7 35793723 missense probably damaging 1.00
R2191:Zfp507 UTSW 7 35794843 missense probably damaging 1.00
R2431:Zfp507 UTSW 7 35795402 missense probably benign 0.08
R2921:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R2922:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R3436:Zfp507 UTSW 7 35787770 missense probably damaging 1.00
R4483:Zfp507 UTSW 7 35787716 critical splice donor site probably null
R4751:Zfp507 UTSW 7 35794382 missense probably damaging 0.99
R4852:Zfp507 UTSW 7 35794055 missense probably benign 0.01
R5298:Zfp507 UTSW 7 35775996 missense probably damaging 0.99
R5707:Zfp507 UTSW 7 35794163 missense probably damaging 1.00
R5785:Zfp507 UTSW 7 35787742 missense probably benign 0.20
R6140:Zfp507 UTSW 7 35794188 missense probably damaging 1.00
R6674:Zfp507 UTSW 7 35794734 missense probably damaging 0.98
R6714:Zfp507 UTSW 7 35787727 missense probably damaging 0.99
R7045:Zfp507 UTSW 7 35795553 missense possibly damaging 0.56
R7334:Zfp507 UTSW 7 35776080 missense probably damaging 1.00
R7365:Zfp507 UTSW 7 35776418 missense unknown
R7569:Zfp507 UTSW 7 35794544 missense probably damaging 0.99
R7662:Zfp507 UTSW 7 35787804 nonsense probably null
R7846:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
R9100:Zfp507 UTSW 7 35795021 missense probably benign 0.39
R9136:Zfp507 UTSW 7 35776458 missense probably damaging 0.96
R9513:Zfp507 UTSW 7 35776148 missense probably benign 0.00
Z1088:Zfp507 UTSW 7 35794277 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCTTCATGTGATCCAGGAGG -3'
(R):5'- CCACCCTTCACTTGATGGCTAG -3'

Sequencing Primer
(F):5'- TGCTGGTTGACTCAAAGCC -3'
(R):5'- CCTTCACTTGATGGCTAGGTACAGAG -3'
Posted On 2016-10-26