Incidental Mutation 'R5602:Asb5'
ID 439083
Institutional Source Beutler Lab
Gene Symbol Asb5
Ensembl Gene ENSMUSG00000031519
Gene Name ankyrin repeat and SOCs box-containing 5
Synonyms 1110018D09Rik
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 54529580-54587842 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54585939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 280 (E280G)
Ref Sequence ENSEMBL: ENSMUSP00000033918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033918]
AlphaFold Q9D1A4
Predicted Effect probably benign
Transcript: ENSMUST00000033918
AA Change: E280G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033918
Gene: ENSMUSG00000031519
AA Change: E280G

DomainStartEndE-ValueType
ANK 69 98 6.26e-2 SMART
ANK 102 131 2.45e-4 SMART
ANK 135 164 7.19e-2 SMART
ANK 167 196 5.58e1 SMART
ANK 200 229 9.35e-1 SMART
ANK 232 261 5.32e-5 SMART
SOCS_box 290 329 5.37e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209937
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but their full length sequences are not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Asb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Asb5 APN 8 54583660 critical splice donor site probably null
IGL01313:Asb5 APN 8 54585763 splice site probably benign
IGL01383:Asb5 APN 8 54550509 missense probably damaging 1.00
IGL03214:Asb5 APN 8 54585063 missense probably benign 0.30
IGL03403:Asb5 APN 8 54583547 splice site probably benign
R2002:Asb5 UTSW 8 54583620 missense probably damaging 1.00
R4768:Asb5 UTSW 8 54584996 missense probably benign 0.00
R4786:Asb5 UTSW 8 54585839 missense probably benign 0.07
R6475:Asb5 UTSW 8 54550575 missense probably damaging 0.99
R6836:Asb5 UTSW 8 54585071 missense probably benign
R7716:Asb5 UTSW 8 54584986 missense probably benign 0.06
R7775:Asb5 UTSW 8 54584792 missense
R7778:Asb5 UTSW 8 54584792 missense
R7824:Asb5 UTSW 8 54584792 missense
R8156:Asb5 UTSW 8 54550506 missense probably damaging 1.00
R9032:Asb5 UTSW 8 54585894 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATACAGGTGCTGATGTGC -3'
(R):5'- GGGCTCAATTACCCAGTATGC -3'

Sequencing Primer
(F):5'- TGCTGATGTGCACAAAGGC -3'
(R):5'- GTGATGCAGCTAAAAATTGTGTCAG -3'
Posted On 2016-10-26