Incidental Mutation 'R5602:Olfr954'
ID 439084
Institutional Source Beutler Lab
Gene Symbol Olfr954
Ensembl Gene ENSMUSG00000094745
Gene Name olfactory receptor 954
Synonyms GA_x6K02T2PVTD-33158015-33158950, MOR171-53, MOR171-42
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 39456701-39464625 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39462030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 200 (M200L)
Ref Sequence ENSEMBL: ENSMUSP00000079205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
AlphaFold Q9EQB6
Predicted Effect probably benign
Transcript: ENSMUST00000080329
AA Change: M200L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: M200L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214818
AA Change: M197L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Olfr954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Olfr954 APN 9 39462283 missense probably damaging 0.98
IGL02793:Olfr954 APN 9 39461506 missense probably benign 0.09
IGL02964:Olfr954 APN 9 39461781 missense possibly damaging 0.88
IGL02979:Olfr954 APN 9 39461523 missense probably benign 0.02
R0041:Olfr954 UTSW 9 39461476 missense probably benign 0.34
R0153:Olfr954 UTSW 9 39461671 missense probably damaging 0.99
R0269:Olfr954 UTSW 9 39461794 missense probably damaging 1.00
R0426:Olfr954 UTSW 9 39461593 missense probably damaging 1.00
R0731:Olfr954 UTSW 9 39461532 missense probably damaging 1.00
R1800:Olfr954 UTSW 9 39462114 missense probably damaging 1.00
R2340:Olfr954 UTSW 9 39461809 missense probably damaging 1.00
R2901:Olfr954 UTSW 9 39461938 missense probably damaging 0.97
R2912:Olfr954 UTSW 9 39462216 missense probably damaging 1.00
R2939:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R2940:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3081:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3765:Olfr954 UTSW 9 39461624 nonsense probably null
R4450:Olfr954 UTSW 9 39462032 missense probably benign 0.00
R4515:Olfr954 UTSW 9 39462231 nonsense probably null
R4786:Olfr954 UTSW 9 39461841 missense probably benign 0.16
R4961:Olfr954 UTSW 9 39461887 missense probably damaging 1.00
R5219:Olfr954 UTSW 9 39462267 missense probably benign 0.09
R5887:Olfr954 UTSW 9 39461491 missense probably damaging 1.00
R5950:Olfr954 UTSW 9 39462337 missense probably benign 0.01
R6943:Olfr954 UTSW 9 39461863 missense probably benign 0.05
R7567:Olfr954 UTSW 9 39461877 missense possibly damaging 0.92
R8817:Olfr954 UTSW 9 39462091 missense probably damaging 1.00
R9251:Olfr954 UTSW 9 39462372 missense probably benign
X0060:Olfr954 UTSW 9 39462274 missense probably damaging 1.00
Z1177:Olfr954 UTSW 9 39461701 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGACCGCTATGTTGCCATCTG -3'
(R):5'- TGCTGTAGAACCATAGAAGACAGC -3'

Sequencing Primer
(F):5'- ACCCCTTGGTTTACAATATAGCCATG -3'
(R):5'- TGTAGAACCATAGAAGACAGCAACAG -3'
Posted On 2016-10-26