Incidental Mutation 'R5602:Olfr969'
ID 439085
Institutional Source Beutler Lab
Gene Symbol Olfr969
Ensembl Gene ENSMUSG00000094254
Gene Name olfactory receptor 969
Synonyms GA_x6K02T2PVTD-33492981-33493916, MOR171-7
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 39790945-39796635 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39796194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 273 (V273E)
Ref Sequence ENSEMBL: ENSMUSP00000149551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074566] [ENSMUST00000213266]
AlphaFold Q8VG89
Predicted Effect possibly damaging
Transcript: ENSMUST00000074566
AA Change: V273E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074151
Gene: ENSMUSG00000094254
AA Change: V273E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-50 PFAM
Pfam:7tm_1 41 290 2.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213266
AA Change: V273E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Olfr969
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr969 APN 9 39795378 start codon destroyed probably null 1.00
IGL02108:Olfr969 APN 9 39795512 missense probably damaging 0.99
IGL02999:Olfr969 APN 9 39795456 missense probably damaging 1.00
IGL03089:Olfr969 APN 9 39795681 missense probably benign 0.18
IGL03107:Olfr969 APN 9 39796179 missense probably benign 0.03
R1232:Olfr969 UTSW 9 39795968 missense probably benign 0.18
R1682:Olfr969 UTSW 9 39795658 nonsense probably null
R1796:Olfr969 UTSW 9 39796005 missense possibly damaging 0.82
R2152:Olfr969 UTSW 9 39795647 missense probably benign 0.01
R4534:Olfr969 UTSW 9 39796000 missense probably benign 0.00
R4941:Olfr969 UTSW 9 39795864 missense possibly damaging 0.78
R5239:Olfr969 UTSW 9 39796196 missense probably damaging 0.99
R6681:Olfr969 UTSW 9 39795414 missense probably benign 0.02
R6819:Olfr969 UTSW 9 39795609 missense probably benign 0.00
R7066:Olfr969 UTSW 9 39796124 missense probably benign 0.00
R7138:Olfr969 UTSW 9 39795790 nonsense probably null
R8995:Olfr969 UTSW 9 39796017 missense possibly damaging 0.52
R9446:Olfr969 UTSW 9 39796046 missense probably damaging 1.00
Z1176:Olfr969 UTSW 9 39795929 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTCTTACATCTTCATCATAGCCAG -3'
(R):5'- ATTTGCTAAAACTGTCCTGCCC -3'

Sequencing Primer
(F):5'- TCATAGCCAGCATCCTCCGG -3'
(R):5'- GGCAGTAATTTCATATCATGTTGCCC -3'
Posted On 2016-10-26