Incidental Mutation 'R5602:Mlh1'
ID 439089
Institutional Source Beutler Lab
Gene Symbol Mlh1
Ensembl Gene ENSMUSG00000032498
Gene Name mutL homolog 1
Synonyms colon cancer, nonpolyposis type 2, 1110035C23Rik
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 111228228-111271791 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111252878 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 259 (L259Q)
Ref Sequence ENSEMBL: ENSMUSP00000035079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035079] [ENSMUST00000135218] [ENSMUST00000135695]
AlphaFold Q9JK91
Predicted Effect probably damaging
Transcript: ENSMUST00000035079
AA Change: L259Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498
AA Change: L259Q

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134316
Predicted Effect probably benign
Transcript: ENSMUST00000135218
Predicted Effect probably benign
Transcript: ENSMUST00000135695
SMART Domains Protein: ENSMUSP00000119170
Gene: ENSMUSG00000032498

DomainStartEndE-ValueType
Blast:HATPase_c 1 53 8e-33 BLAST
SCOP:d1b63a2 1 75 7e-22 SMART
PDB:4P7A|A 1 76 2e-47 PDB
Predicted Effect unknown
Transcript: ENSMUST00000199404
AA Change: L53Q
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Mlh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Mlh1 APN 9 111252912 missense possibly damaging 0.84
IGL02530:Mlh1 APN 9 111229875 missense probably benign 0.09
IGL02811:Mlh1 APN 9 111271514 missense probably benign 0.04
IGL02892:Mlh1 APN 9 111252969 missense probably benign 0.00
IGL03394:Mlh1 APN 9 111268243 missense probably damaging 1.00
andalusia UTSW 9 111271410 makesense probably null
andalusia2 UTSW 9 111271523 start codon destroyed probably null 0.93
andalusia3 UTSW 9 111229838 critical splice donor site probably null
ANU23:Mlh1 UTSW 9 111252912 missense possibly damaging 0.84
PIT4495001:Mlh1 UTSW 9 111247260 missense probably benign 0.00
R0496:Mlh1 UTSW 9 111241556 missense probably benign
R0723:Mlh1 UTSW 9 111271472 missense probably damaging 1.00
R1395:Mlh1 UTSW 9 111247377 missense probably damaging 1.00
R1694:Mlh1 UTSW 9 111228475 missense probably damaging 1.00
R1762:Mlh1 UTSW 9 111229929 missense probably damaging 1.00
R1865:Mlh1 UTSW 9 111257024 intron probably benign
R1885:Mlh1 UTSW 9 111258556 missense probably benign 0.18
R1992:Mlh1 UTSW 9 111228563 missense probably damaging 0.96
R2186:Mlh1 UTSW 9 111258566 unclassified probably benign
R2680:Mlh1 UTSW 9 111236017 critical splice acceptor site probably null
R4693:Mlh1 UTSW 9 111255658 missense probably damaging 1.00
R4784:Mlh1 UTSW 9 111239798 missense probably benign
R5007:Mlh1 UTSW 9 111271410 makesense probably null
R5130:Mlh1 UTSW 9 111229838 critical splice donor site probably null
R5166:Mlh1 UTSW 9 111241513 missense probably benign 0.04
R5265:Mlh1 UTSW 9 111271523 start codon destroyed probably null 0.93
R5481:Mlh1 UTSW 9 111229837 splice site probably null
R5483:Mlh1 UTSW 9 111231058 missense possibly damaging 0.82
R5658:Mlh1 UTSW 9 111247380 missense probably damaging 0.99
R5890:Mlh1 UTSW 9 111228495 missense possibly damaging 0.88
R6810:Mlh1 UTSW 9 111241558 missense possibly damaging 0.52
R7607:Mlh1 UTSW 9 111229890 missense probably damaging 1.00
R7753:Mlh1 UTSW 9 111252863 critical splice donor site probably null
R7894:Mlh1 UTSW 9 111230077 splice site probably null
R7912:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
R7995:Mlh1 UTSW 9 111235921 missense probably damaging 1.00
R8097:Mlh1 UTSW 9 111256092 critical splice donor site probably null
R8280:Mlh1 UTSW 9 111249218 critical splice donor site probably null
R8804:Mlh1 UTSW 9 111264904 missense probably damaging 1.00
R9562:Mlh1 UTSW 9 111230945 missense
Predicted Primers PCR Primer
(F):5'- CACTGCTCAAGGTAAAGGCG -3'
(R):5'- GACCTCAGCTAAACCTAGTCTC -3'

Sequencing Primer
(F):5'- CGAGTGTGACAGCCAGCAAC -3'
(R):5'- GGTGTGAGGATAAAACCCTA -3'
Posted On 2016-10-26