Mutagenetix > Incidental Mutation

Incidental Mutation 'R5602:Supv3l1'

439091

Institutional Source

Beutler Lab

Gene Symbol

Supv3l1

Ensembl Gene

ENSMUSG00000020079

Gene Name

suppressor of var1, 3-like 1 (S. cerevisiae)

Synonyms

MMRRC Submission

043154-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5602 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62429209-62449738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62430592 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 602 (P602S)

Ref Sequence

ENSEMBL: ENSMUSP00000020273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020273]

AlphaFold

Q80YD1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020273
AA Change: P602S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020273
Gene: ENSMUSG00000020079
AA Change: P602S

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	47	56	N/A	INTRINSIC
HELICc	379	475	1.44e-18	SMART
Pfam:SUV3_C	625	672	4e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161830

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161941

Predicted Effect

probably benign
Transcript: ENSMUST00000162023

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit embryonic lethality between E9.5 and E12.5. Mice homozygous for a knock-out allele exhibit embryonic lethality between E8.5 and 9.5. Mice heterozygous for this allele produce offspring with mitochondrial defects regardless of offspring genotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	G	A	9: 92,352,668	C152Y	possibly damaging	Het
4921509C19Rik	G	A	2: 151,473,539	S73F	possibly damaging	Het
4932414N04Rik	A	T	2: 68,748,368	*753L	probably null	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adam19	T	C	11: 46,136,315	S592P	probably benign	Het
Adamtsl3	A	G	7: 82,557,239	K843R	possibly damaging	Het
Ap2a2	A	T	7: 141,604,942	T213S	probably benign	Het
Asb5	A	G	8: 54,585,939	E280G	probably benign	Het
Becn1	T	C	11: 101,288,952	D403G	probably damaging	Het
Ccr7	G	T	11: 99,145,489	N202K	probably benign	Het
Cd36	T	C	5: 17,814,792	T104A	possibly damaging	Het
Cnot4	C	T	6: 35,051,529	W384*	probably null	Het
Col15a1	G	A	4: 47,312,087	V1301M	probably damaging	Het
Dock2	C	A	11: 34,254,391	A1384S	probably benign	Het
Ehbp1l1	T	C	19: 5,708,670	E1648G	possibly damaging	Het
Fbn1	G	T	2: 125,321,741	A2065E	possibly damaging	Het
Fras1	A	G	5: 96,737,021	Y2586C	probably damaging	Het
Galm	T	A	17: 80,150,139	Y28*	probably null	Het
Ggt7	A	G	2: 155,490,999	V648A	possibly damaging	Het
Gm17067	T	A	7: 42,708,415	D221V	probably damaging	Het
Gpr3	T	C	4: 133,210,494	N289S	probably damaging	Het
Ighv11-2	G	A	12: 114,048,479	L39F	probably damaging	Het
Ighv11-2	A	G	12: 114,048,657		probably benign	Het
Ipo9	G	A	1: 135,402,245	L486F	probably damaging	Het
Jak2	T	A	19: 29,298,339	N726K	probably benign	Het
Map4	T	C	9: 110,052,700	S211P	possibly damaging	Het
Mlh1	A	T	9: 111,252,878	L259Q	probably damaging	Het
Naa25	A	G	5: 121,420,495	E300G	probably benign	Het
Olfr954	A	T	9: 39,462,030	M200L	probably benign	Het
Olfr969	T	A	9: 39,796,194	V273E	possibly damaging	Het
Parva	G	A	7: 112,567,765	V182I	probably benign	Het
Pcdhgb4	T	C	18: 37,721,644	I364T	probably damaging	Het
Pdik1l	A	G	4: 134,284,269	S164P	probably damaging	Het
Pfas	A	T	11: 68,991,045	I938N	probably benign	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Prob1	C	T	18: 35,654,026	V392M	possibly damaging	Het
Rasgrf1	T	C	9: 89,911,571	S134P	possibly damaging	Het
Rorb	T	A	19: 18,977,937	Y20F	probably damaging	Het
Rsph9	G	T	17: 46,134,983	D220E	probably damaging	Het
Safb2	C	A	17: 56,575,630	K334N	possibly damaging	Het
Sall3	T	C	18: 80,972,812	T634A	probably benign	Het
Scaf1	A	G	7: 45,007,583		probably benign	Het
Slco1a5	T	A	6: 142,275,529		probably benign	Het
Spata21	C	T	4: 141,096,899	R158C	probably benign	Het
Srrm2	G	A	17: 23,819,337		probably benign	Het
Stk38l	C	A	6: 146,758,500	T10N	probably benign	Het
Timm44	C	T	8: 4,266,769		probably null	Het
Tll2	T	A	19: 41,104,981	R465S	possibly damaging	Het
Tmem104	G	A	11: 115,205,124	A164T	probably damaging	Het
Tmem151b	A	G	17: 45,545,600	S305P	probably damaging	Het
Utrn	T	C	10: 12,750,095	D114G	probably damaging	Het
Vmn2r109	A	T	17: 20,540,671	M808K	possibly damaging	Het
Washc2	T	A	6: 116,248,095	D801E	possibly damaging	Het
Xkr4	T	C	1: 3,216,528	I480V	probably benign	Het
Zfp507	G	T	7: 35,776,238	S58*	probably null	Het
Zfp768	T	A	7: 127,344,632	D108V	possibly damaging	Het

Other mutations in Supv3l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03067:Supv3l1	APN	10	62429821	missense	probably damaging	1.00
R0090:Supv3l1	UTSW	10	62429706	missense	probably benign	0.00
R0477:Supv3l1	UTSW	10	62430585	missense	probably damaging	0.98
R0946:Supv3l1	UTSW	10	62429820	missense	probably damaging	1.00
R1460:Supv3l1	UTSW	10	62443383	splice site	probably benign
R1546:Supv3l1	UTSW	10	62432446	missense	probably benign	0.08
R1941:Supv3l1	UTSW	10	62449612	missense	probably benign
R3916:Supv3l1	UTSW	10	62449420	missense	possibly damaging	0.67
R5030:Supv3l1	UTSW	10	62430615	missense	probably damaging	1.00
R5040:Supv3l1	UTSW	10	62447065	missense	possibly damaging	0.93
R5051:Supv3l1	UTSW	10	62443417	missense	probably damaging	0.99
R5085:Supv3l1	UTSW	10	62435512	missense	probably benign	0.00
R5288:Supv3l1	UTSW	10	62430596	missense	possibly damaging	0.90
R5359:Supv3l1	UTSW	10	62432399	missense	probably damaging	0.96
R5372:Supv3l1	UTSW	10	62432357	missense	probably damaging	0.99
R5384:Supv3l1	UTSW	10	62430596	missense	possibly damaging	0.90
R5385:Supv3l1	UTSW	10	62430596	missense	possibly damaging	0.90
R5527:Supv3l1	UTSW	10	62429829	missense	probably damaging	1.00
R5713:Supv3l1	UTSW	10	62430504	missense	possibly damaging	0.91
R6150:Supv3l1	UTSW	10	62435722	missense	possibly damaging	0.90
R6220:Supv3l1	UTSW	10	62439021	missense	possibly damaging	0.82
R6903:Supv3l1	UTSW	10	62441237	missense	probably damaging	1.00
R6941:Supv3l1	UTSW	10	62430586	missense	possibly damaging	0.86
R7187:Supv3l1	UTSW	10	62435549	missense	probably damaging	1.00
R7250:Supv3l1	UTSW	10	62445067	missense	probably damaging	1.00
R7438:Supv3l1	UTSW	10	62430470	critical splice donor site	probably null
R7439:Supv3l1	UTSW	10	62430615	missense	probably damaging	0.99
R7515:Supv3l1	UTSW	10	62432311	missense	probably damaging	1.00
R7579:Supv3l1	UTSW	10	62435708	missense	probably damaging	1.00
R7579:Supv3l1	UTSW	10	62435709	missense	possibly damaging	0.61
R7923:Supv3l1	UTSW	10	62445081	missense	probably damaging	0.98
R7973:Supv3l1	UTSW	10	62449423	missense	probably damaging	1.00
R8098:Supv3l1	UTSW	10	62429503	missense	probably benign	0.01
R8327:Supv3l1	UTSW	10	62441225	missense	probably damaging	1.00
R8699:Supv3l1	UTSW	10	62432455	missense	possibly damaging	0.95
R8947:Supv3l1	UTSW	10	62432339	missense	probably benign	0.28
R9169:Supv3l1	UTSW	10	62432459	missense	probably damaging	1.00
R9509:Supv3l1	UTSW	10	62429632	missense	probably benign
R9520:Supv3l1	UTSW	10	62432402	missense	probably damaging	1.00
RF016:Supv3l1	UTSW	10	62437508	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TAAACTTTCTACCTTGACGGAGCA -3'
(R):5'- TGTCTTTTCAAATATAGTAGGAAAGCG -3'

Sequencing Primer
(F):5'- TTTCTACCTTGACGGAGCAGAAGC -3'
(R):5'- CGTTAAGTAGCAATGAAACCAGCCTG -3'

Posted On

2016-10-26