Mutagenetix > Incidental Mutation

Incidental Mutation 'R5602:Adam19'

439094

Institutional Source

Beutler Lab

Gene Symbol

Adam19

Ensembl Gene

ENSMUSG00000011256

Gene Name

a disintegrin and metallopeptidase domain 19 (meltrin beta)

Synonyms

Mltnb

MMRRC Submission

043154-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5602 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46055992-46147343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46136315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 592 (S592P)

Ref Sequence

ENSEMBL: ENSMUSP00000011400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011400]

AlphaFold

O35674

Predicted Effect

probably benign
Transcript: ENSMUST00000011400
AA Change: S592P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: S592P

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	163	9.4e-27	PFAM
Pfam:Reprolysin_5	209	388	1.9e-25	PFAM
Pfam:Reprolysin_4	209	399	1.5e-15	PFAM
Pfam:Reprolysin	211	409	1.3e-68	PFAM
Pfam:Reprolysin_2	231	399	6.1e-19	PFAM
Pfam:Reprolysin_3	235	357	1.2e-19	PFAM
DISIN	426	501	9.7e-41	SMART
ACR	502	650	7.46e-62	SMART
transmembrane domain	704	726	N/A	INTRINSIC
low complexity region	788	797	N/A	INTRINSIC
low complexity region	832	846	N/A	INTRINSIC
low complexity region	886	905	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153410

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	G	A	9: 92,352,668	C152Y	possibly damaging	Het
4921509C19Rik	G	A	2: 151,473,539	S73F	possibly damaging	Het
4932414N04Rik	A	T	2: 68,748,368	*753L	probably null	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adamtsl3	A	G	7: 82,557,239	K843R	possibly damaging	Het
Ap2a2	A	T	7: 141,604,942	T213S	probably benign	Het
Asb5	A	G	8: 54,585,939	E280G	probably benign	Het
Becn1	T	C	11: 101,288,952	D403G	probably damaging	Het
Ccr7	G	T	11: 99,145,489	N202K	probably benign	Het
Cd36	T	C	5: 17,814,792	T104A	possibly damaging	Het
Cnot4	C	T	6: 35,051,529	W384*	probably null	Het
Col15a1	G	A	4: 47,312,087	V1301M	probably damaging	Het
Dock2	C	A	11: 34,254,391	A1384S	probably benign	Het
Ehbp1l1	T	C	19: 5,708,670	E1648G	possibly damaging	Het
Fbn1	G	T	2: 125,321,741	A2065E	possibly damaging	Het
Fras1	A	G	5: 96,737,021	Y2586C	probably damaging	Het
Galm	T	A	17: 80,150,139	Y28*	probably null	Het
Ggt7	A	G	2: 155,490,999	V648A	possibly damaging	Het
Gm17067	T	A	7: 42,708,415	D221V	probably damaging	Het
Gpr3	T	C	4: 133,210,494	N289S	probably damaging	Het
Ighv11-2	G	A	12: 114,048,479	L39F	probably damaging	Het
Ighv11-2	A	G	12: 114,048,657		probably benign	Het
Ipo9	G	A	1: 135,402,245	L486F	probably damaging	Het
Jak2	T	A	19: 29,298,339	N726K	probably benign	Het
Map4	T	C	9: 110,052,700	S211P	possibly damaging	Het
Mlh1	A	T	9: 111,252,878	L259Q	probably damaging	Het
Naa25	A	G	5: 121,420,495	E300G	probably benign	Het
Olfr954	A	T	9: 39,462,030	M200L	probably benign	Het
Olfr969	T	A	9: 39,796,194	V273E	possibly damaging	Het
Parva	G	A	7: 112,567,765	V182I	probably benign	Het
Pcdhgb4	T	C	18: 37,721,644	I364T	probably damaging	Het
Pdik1l	A	G	4: 134,284,269	S164P	probably damaging	Het
Pfas	A	T	11: 68,991,045	I938N	probably benign	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Prob1	C	T	18: 35,654,026	V392M	possibly damaging	Het
Rasgrf1	T	C	9: 89,911,571	S134P	possibly damaging	Het
Rorb	T	A	19: 18,977,937	Y20F	probably damaging	Het
Rsph9	G	T	17: 46,134,983	D220E	probably damaging	Het
Safb2	C	A	17: 56,575,630	K334N	possibly damaging	Het
Sall3	T	C	18: 80,972,812	T634A	probably benign	Het
Scaf1	A	G	7: 45,007,583		probably benign	Het
Slco1a5	T	A	6: 142,275,529		probably benign	Het
Spata21	C	T	4: 141,096,899	R158C	probably benign	Het
Srrm2	G	A	17: 23,819,337		probably benign	Het
Stk38l	C	A	6: 146,758,500	T10N	probably benign	Het
Supv3l1	G	A	10: 62,430,592	P602S	possibly damaging	Het
Timm44	C	T	8: 4,266,769		probably null	Het
Tll2	T	A	19: 41,104,981	R465S	possibly damaging	Het
Tmem104	G	A	11: 115,205,124	A164T	probably damaging	Het
Tmem151b	A	G	17: 45,545,600	S305P	probably damaging	Het
Utrn	T	C	10: 12,750,095	D114G	probably damaging	Het
Vmn2r109	A	T	17: 20,540,671	M808K	possibly damaging	Het
Washc2	T	A	6: 116,248,095	D801E	possibly damaging	Het
Xkr4	T	C	1: 3,216,528	I480V	probably benign	Het
Zfp507	G	T	7: 35,776,238	S58*	probably null	Het
Zfp768	T	A	7: 127,344,632	D108V	possibly damaging	Het

Other mutations in Adam19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Adam19	APN	11	46112783	missense	probably damaging	1.00
IGL01727:Adam19	APN	11	46121553	missense	probably benign
IGL01758:Adam19	APN	11	46112924	missense	probably benign	0.01
IGL02160:Adam19	APN	11	46139695	missense	probably damaging	0.99
IGL02421:Adam19	APN	11	46137553	missense	probably damaging	0.96
IGL02572:Adam19	APN	11	46131721	nonsense	probably null
IGL02995:Adam19	APN	11	46136349	missense	probably benign	0.00
IGL03171:Adam19	APN	11	46138854	missense	probably damaging	0.98
IGL03237:Adam19	APN	11	46137556	missense	probably benign
R0003:Adam19	UTSW	11	46128789	missense	probably damaging	1.00
R0026:Adam19	UTSW	11	46136259	missense	probably damaging	1.00
R0158:Adam19	UTSW	11	46143034	missense	probably damaging	1.00
R0304:Adam19	UTSW	11	46127392	missense	possibly damaging	0.91
R0488:Adam19	UTSW	11	46138930	missense	probably damaging	0.98
R0501:Adam19	UTSW	11	46123130	missense	probably damaging	1.00
R0591:Adam19	UTSW	11	46121411	splice site	probably benign
R0734:Adam19	UTSW	11	46127403	missense	probably damaging	0.99
R0747:Adam19	UTSW	11	46118495	splice site	probably null
R0771:Adam19	UTSW	11	46121453	missense	possibly damaging	0.92
R1052:Adam19	UTSW	11	46127265	missense	probably damaging	0.99
R1573:Adam19	UTSW	11	46113618	splice site	probably benign
R1735:Adam19	UTSW	11	46138917	missense	probably benign	0.26
R1830:Adam19	UTSW	11	46127278	missense	probably damaging	0.98
R1911:Adam19	UTSW	11	46121454	missense	probably damaging	1.00
R2092:Adam19	UTSW	11	46060904	splice site	probably null
R3749:Adam19	UTSW	11	46137610	missense	probably benign	0.00
R3893:Adam19	UTSW	11	46128838	missense	probably damaging	1.00
R3916:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R3917:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R4506:Adam19	UTSW	11	46118444	missense	possibly damaging	0.67
R4767:Adam19	UTSW	11	46138977	critical splice donor site	probably null
R5055:Adam19	UTSW	11	46123169	missense	probably damaging	1.00
R5313:Adam19	UTSW	11	46131776	missense	probably damaging	1.00
R5329:Adam19	UTSW	11	46125026	missense	probably damaging	0.99
R5567:Adam19	UTSW	11	46136250	missense	probably damaging	1.00
R6198:Adam19	UTSW	11	46121502	missense	probably damaging	1.00
R6875:Adam19	UTSW	11	46112875	missense	probably benign
R7011:Adam19	UTSW	11	46143018	missense	probably benign	0.00
R7163:Adam19	UTSW	11	46131717	missense	probably benign
R7213:Adam19	UTSW	11	46121471	missense	probably benign	0.20
R7267:Adam19	UTSW	11	46121576	nonsense	probably null
R7896:Adam19	UTSW	11	46137543	missense	probably damaging	1.00
R8012:Adam19	UTSW	11	46065046	missense	possibly damaging	0.74
R8059:Adam19	UTSW	11	46136466	splice site	probably benign
R8243:Adam19	UTSW	11	46125082	missense	probably damaging	1.00
R8357:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R8419:Adam19	UTSW	11	46125023	missense	possibly damaging	0.77
R8457:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R9163:Adam19	UTSW	11	46127349	missense	probably benign	0.02
R9349:Adam19	UTSW	11	46131743	nonsense	probably null
R9489:Adam19	UTSW	11	46137622	missense	probably benign	0.10
R9579:Adam19	UTSW	11	46118435	missense	probably benign	0.00
X0067:Adam19	UTSW	11	46056115	start codon destroyed	probably null	0.06

Predicted Primers

PCR Primer
(F):5'- TGAGACACAAGGAACCTGCC -3'
(R):5'- TTCTGAGAGCTGGGCATCAC -3'

Sequencing Primer
(F):5'- AAGGAACCTGCCCCTTTTCTGG -3'
(R):5'- AGAGCTGGGCATCACTCCTC -3'

Posted On

2016-10-26