Incidental Mutation 'R5602:Becn1'
ID 439097
Institutional Source Beutler Lab
Gene Symbol Becn1
Ensembl Gene ENSMUSG00000035086
Gene Name beclin 1, autophagy related
Synonyms Atg6
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5602 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 101285952-101302286 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101288952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 403 (D403G)
Ref Sequence ENSEMBL: ENSMUSP00000119369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041403] [ENSMUST00000103107] [ENSMUST00000126195] [ENSMUST00000129863] [ENSMUST00000130916] [ENSMUST00000172233] [ENSMUST00000167667] [ENSMUST00000167818]
AlphaFold O88597
PDB Structure Crystal Structure of M11, the BCL-2 Homolog of Murine Gamma-herpesvirus 68, Complexed with Mouse Beclin1 (residues 106-124) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041403
Predicted Effect probably benign
Transcript: ENSMUST00000103107
SMART Domains Protein: ENSMUSP00000099396
Gene: ENSMUSG00000078653

DomainStartEndE-ValueType
Pfam:Cyclin_N 111 180 1.8e-6 PFAM
low complexity region 212 221 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122817
Predicted Effect probably benign
Transcript: ENSMUST00000126195
SMART Domains Protein: ENSMUSP00000122168
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:BH3 35 59 5.6e-22 PFAM
Pfam:APG6 65 147 1.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128735
Predicted Effect probably benign
Transcript: ENSMUST00000129863
SMART Domains Protein: ENSMUSP00000116580
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:APG6 6 125 1.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130916
AA Change: D403G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119369
Gene: ENSMUSG00000035086
AA Change: D403G

DomainStartEndE-ValueType
Pfam:BH3 103 127 4.1e-20 PFAM
Pfam:APG6 133 444 1.1e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153438
Predicted Effect probably benign
Transcript: ENSMUST00000172233
SMART Domains Protein: ENSMUSP00000129156
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:APG6 79 274 3.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167667
Predicted Effect probably benign
Transcript: ENSMUST00000167818
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates autophagy, a catabolic process of degradation induced by starvation. The encoded protein is a component of the phosphatidylinositol-3-kinase (PI3K) complex which mediates vesicle-trafficking processes. This protein is thought to play a role in multiple cellular processes, including tumorigenesis, neurodegeneration and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit premature death, increased tumor incidence and reduced autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Ehbp1l1 T C 19: 5,708,670 E1648G possibly damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Becn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Becn1 APN 11 101295622 missense probably benign 0.39
IGL01296:Becn1 APN 11 101291451 missense probably damaging 1.00
IGL01303:Becn1 APN 11 101294985 missense possibly damaging 0.92
IGL01311:Becn1 APN 11 101291516 missense probably damaging 1.00
IGL02269:Becn1 APN 11 101291535 splice site probably benign
IGL02472:Becn1 APN 11 101291398 missense probably benign 0.03
indisposed UTSW 11 101291510 missense probably damaging 1.00
R0123:Becn1 UTSW 11 101290498 missense probably damaging 1.00
R0147:Becn1 UTSW 11 101301736 missense probably damaging 1.00
R0453:Becn1 UTSW 11 101290449 missense probably damaging 1.00
R1422:Becn1 UTSW 11 101295126 missense possibly damaging 0.92
R1840:Becn1 UTSW 11 101295566 missense probably damaging 1.00
R4097:Becn1 UTSW 11 101294266 intron probably benign
R5041:Becn1 UTSW 11 101288836 missense probably benign 0.30
R5119:Becn1 UTSW 11 101291395 missense probably damaging 1.00
R5319:Becn1 UTSW 11 101288803 utr 3 prime probably benign
R6178:Becn1 UTSW 11 101291510 missense probably damaging 1.00
R6190:Becn1 UTSW 11 101295374 missense probably damaging 1.00
R7076:Becn1 UTSW 11 101295324 missense probably benign
R7438:Becn1 UTSW 11 101294226 missense probably benign 0.00
R7831:Becn1 UTSW 11 101290453 missense probably benign 0.00
R8220:Becn1 UTSW 11 101296279 missense possibly damaging 0.95
R8818:Becn1 UTSW 11 101295404 missense probably damaging 0.98
R9422:Becn1 UTSW 11 101302006 intron probably benign
X0011:Becn1 UTSW 11 101289822 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGCGTACTCTGGAAACTATCTG -3'
(R):5'- ACACTAGCGGTAATTCTTTGCC -3'

Sequencing Primer
(F):5'- ACTCTGGAAACTATCTGTCATATTTG -3'
(R):5'- CGGTAATTCTTTGCCAGGCG -3'
Posted On 2016-10-26