Mutagenetix > Incidental Mutation

Incidental Mutation 'R5603:Grin2b'

439135

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b

MMRRC Submission

043155-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5603 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135690231-136150509 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135900395 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 162 (E162G)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000152012]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: E162G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: E162G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: E162G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: E162G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152012
AA Change: E162G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: E162G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	66	312	1.6e-9	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Baiap2l1	A	G	5: 144,202,787 (GRCm39)	S509P	probably damaging	Het
Bud31	T	C	5: 145,081,769 (GRCm39)	I52T	possibly damaging	Het
Cacna1g	C	T	11: 94,330,578 (GRCm39)	S979N	possibly damaging	Het
Cacna2d4	T	A	6: 119,221,246 (GRCm39)	W253R	probably damaging	Het
Ccna1	A	G	3: 54,958,330 (GRCm39)	Y118H	probably damaging	Het
Cct8l1	A	G	5: 25,721,497 (GRCm39)	T71A	probably benign	Het
Chaf1b	A	G	16: 93,689,683 (GRCm39)	T19A	probably damaging	Het
Col6a2	A	T	10: 76,432,603 (GRCm39)	V850D	probably damaging	Het
Cpsf2	C	A	12: 101,964,890 (GRCm39)	Q513K	probably benign	Het
Dnah5	T	G	15: 28,420,078 (GRCm39)	V3792G	probably damaging	Het
Dnajb12	GC	G	10: 59,728,574 (GRCm39)		probably null	Het
Exoc6b	T	C	6: 84,812,126 (GRCm39)	D625G	possibly damaging	Het
Gad1	C	A	2: 70,420,173 (GRCm39)	F352L	probably damaging	Het
Gm5422	T	A	10: 31,126,840 (GRCm39)		noncoding transcript	Het
Grm6	T	A	11: 50,747,786 (GRCm39)	F333I	probably damaging	Het
Heatr5a	A	G	12: 51,924,358 (GRCm39)	F1952L	probably benign	Het
Ighv1-42	C	T	12: 114,901,132 (GRCm39)		probably benign	Het
Itgb6	T	C	2: 60,450,706 (GRCm39)	T578A	probably benign	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Mfsd14b	T	C	13: 65,221,420 (GRCm39)	K291E	probably benign	Het
Mllt6	T	C	11: 97,564,331 (GRCm39)	L379P	probably damaging	Het
Mtmr6	A	T	14: 60,522,450 (GRCm39)	K183*	probably null	Het
Mylk	A	G	16: 34,776,862 (GRCm39)	N1345S	probably benign	Het
Nab2	A	T	10: 127,500,990 (GRCm39)	M1K	probably null	Het
Ngly1	C	A	14: 16,260,762 (GRCm38)	Q149K	probably benign	Het
Npy6r	T	A	18: 44,409,652 (GRCm39)	S358T	probably damaging	Het
Pbld2	A	G	10: 62,907,228 (GRCm39)	T156A	probably benign	Het
Pik3cd	A	T	4: 149,743,312 (GRCm39)	C263S	probably benign	Het
Pramel21	T	A	4: 143,344,066 (GRCm39)	C455*	probably null	Het
Ptk2b	A	T	14: 66,409,514 (GRCm39)	Y507*	probably null	Het
Rbm25	C	T	12: 83,710,990 (GRCm39)	R368*	probably null	Het
Rnf207	T	C	4: 152,396,851 (GRCm39)	Y396C	probably damaging	Het
Skint2	T	A	4: 112,506,961 (GRCm39)	V328E	possibly damaging	Het
Slc3a2	A	G	19: 8,691,092 (GRCm39)	V7A	probably benign	Het
Spata18	G	A	5: 73,828,575 (GRCm39)	V265I	probably benign	Het
Tmem120b	T	A	5: 123,239,705 (GRCm39)	V108D	possibly damaging	Het
Ugt1a2	T	C	1: 88,129,148 (GRCm39)	Y264H	probably damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135,713,329 (GRCm39)	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135,710,568 (GRCm39)	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135,713,361 (GRCm39)	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136,021,263 (GRCm39)	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135,710,379 (GRCm39)	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135,710,738 (GRCm39)	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135,709,584 (GRCm39)	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135,713,470 (GRCm39)	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135,716,088 (GRCm39)	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136,020,906 (GRCm39)	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135,900,389 (GRCm39)	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135,756,367 (GRCm39)	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135,899,996 (GRCm39)	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135,716,130 (GRCm39)	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135,716,113 (GRCm39)	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135,757,253 (GRCm39)	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0164:Grin2b	UTSW	6	135,755,646 (GRCm39)	splice site	probably benign
R0194:Grin2b	UTSW	6	135,756,303 (GRCm39)	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135,710,927 (GRCm39)	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135,820,193 (GRCm39)	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136,021,044 (GRCm39)	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135,709,730 (GRCm39)	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136,021,209 (GRCm39)	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135,710,243 (GRCm39)	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135,710,894 (GRCm39)	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135,757,138 (GRCm39)	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135,755,698 (GRCm39)	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135,710,180 (GRCm39)	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135,710,427 (GRCm39)	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135,717,951 (GRCm39)	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135,709,453 (GRCm39)	small deletion	probably benign
R3418:Grin2b	UTSW	6	135,820,108 (GRCm39)	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135,900,269 (GRCm39)	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135,713,433 (GRCm39)	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135,755,739 (GRCm39)	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135,710,823 (GRCm39)	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135,751,870 (GRCm39)	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135,755,697 (GRCm39)	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135,710,405 (GRCm39)	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135,756,393 (GRCm39)	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135,709,439 (GRCm39)	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135,900,297 (GRCm39)	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135,756,340 (GRCm39)	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135,710,916 (GRCm39)	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136,021,281 (GRCm39)	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135,709,366 (GRCm39)	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135,710,721 (GRCm39)	missense	probably benign	0.00
R5657:Grin2b	UTSW	6	135,710,085 (GRCm39)	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135,717,962 (GRCm39)	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135,713,371 (GRCm39)	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135,710,942 (GRCm39)	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135,900,456 (GRCm39)	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135,749,397 (GRCm39)	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135,710,025 (GRCm39)	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135,757,277 (GRCm39)	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135,717,965 (GRCm39)	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135,710,342 (GRCm39)	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135,717,996 (GRCm39)	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135,709,549 (GRCm39)	missense	probably benign
R6647:Grin2b	UTSW	6	135,710,108 (GRCm39)	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135,751,826 (GRCm39)	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135,757,198 (GRCm39)	missense	probably benign
R7033:Grin2b	UTSW	6	135,900,036 (GRCm39)	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135,757,304 (GRCm39)	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135,710,474 (GRCm39)	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135,709,946 (GRCm39)	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135,757,249 (GRCm39)	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135,717,947 (GRCm39)	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135,749,394 (GRCm39)	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135,756,301 (GRCm39)	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135,900,362 (GRCm39)	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135,709,553 (GRCm39)	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135,755,792 (GRCm39)	nonsense	probably null
R8058:Grin2b	UTSW	6	135,710,225 (GRCm39)	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135,710,486 (GRCm39)	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135,709,497 (GRCm39)	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135,900,074 (GRCm39)	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135,899,967 (GRCm39)	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135,710,914 (GRCm39)	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135,899,985 (GRCm39)	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136,021,007 (GRCm39)	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9076:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9172:Grin2b	UTSW	6	135,756,255 (GRCm39)	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135,710,399 (GRCm39)	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135,899,868 (GRCm39)	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136,021,238 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGATGTAGGTGGCTTCTTCC -3'
(R):5'- AGCATGAACTTTTGCATCCAC -3'

Sequencing Primer
(F):5'- AATGATGGGGCTCTGCAGC -3'
(R):5'- GCATCCACTTGATTCACAATCC -3'

Posted On

2016-10-26