Mutagenetix > Incidental Mutation

Incidental Mutation 'R5603:Heatr5a'

439144

Institutional Source

Beutler Lab

Gene Symbol

Heatr5a

Ensembl Gene

ENSMUSG00000035181

Gene Name

HEAT repeat containing 5A

Synonyms

D930036F22Rik

MMRRC Submission

043155-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.348) question?

Stock #

R5603 (G1)

Quality Score

150

Status

Not validated

Chromosome

Chromosomal Location

51875871-51971321 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51877575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1952 (F1952L)

Ref Sequence

ENSEMBL: ENSMUSP00000043115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040583]

AlphaFold

Q5PRF0

Predicted Effect

probably benign
Transcript: ENSMUST00000040583
AA Change: F1952L

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: F1952L

Domain	Start	End	E-Value	Type
low complexity region	56	67	N/A	INTRINSIC
SCOP:d1qbkb_	112	658	6e-13	SMART
low complexity region	1063	1078	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1110	1120	N/A	INTRINSIC
low complexity region	1122	1135	N/A	INTRINSIC
low complexity region	1496	1507	N/A	INTRINSIC
low complexity region	1722	1735	N/A	INTRINSIC
low complexity region	1925	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220369

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Baiap2l1	A	G	5: 144,265,977	S509P	probably damaging	Het
Bud31	T	C	5: 145,144,959	I52T	possibly damaging	Het
Cacna1g	C	T	11: 94,439,752	S979N	possibly damaging	Het
Cacna2d4	T	A	6: 119,244,285	W253R	probably damaging	Het
Ccna1	A	G	3: 55,050,909	Y118H	probably damaging	Het
Cct8l1	A	G	5: 25,516,499	T71A	probably benign	Het
Chaf1b	A	G	16: 93,892,795	T19A	probably damaging	Het
Col6a2	A	T	10: 76,596,769	V850D	probably damaging	Het
Cpsf2	C	A	12: 101,998,631	Q513K	probably benign	Het
Dnah5	T	G	15: 28,419,932	V3792G	probably damaging	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Exoc6b	T	C	6: 84,835,144	D625G	possibly damaging	Het
Gad1	C	A	2: 70,589,829	F352L	probably damaging	Het
Gm13083	T	A	4: 143,617,496	C455*	probably null	Het
Gm5422	T	A	10: 31,250,844		noncoding transcript	Het
Grin2b	T	C	6: 135,923,397	E162G	probably damaging	Het
Grm6	T	A	11: 50,856,959	F333I	probably damaging	Het
Ighv1-42	C	T	12: 114,937,512		probably benign	Het
Itgb6	T	C	2: 60,620,362	T578A	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Mfsd14b	T	C	13: 65,073,606	K291E	probably benign	Het
Mllt6	T	C	11: 97,673,505	L379P	probably damaging	Het
Mtmr6	A	T	14: 60,285,001	K183*	probably null	Het
Mylk	A	G	16: 34,956,492	N1345S	probably benign	Het
Nab2	A	T	10: 127,665,121	M1K	probably null	Het
Ngly1	C	A	14: 16,260,762	Q149K	probably benign	Het
Npy6r	T	A	18: 44,276,585	S358T	probably damaging	Het
Pbld2	A	G	10: 63,071,449	T156A	probably benign	Het
Pik3cd	A	T	4: 149,658,855	C263S	probably benign	Het
Ptk2b	A	T	14: 66,172,065	Y507*	probably null	Het
Rbm25	C	T	12: 83,664,216	R368*	probably null	Het
Rnf207	T	C	4: 152,312,394	Y396C	probably damaging	Het
Skint2	T	A	4: 112,649,764	V328E	possibly damaging	Het
Slc3a2	A	G	19: 8,713,728	V7A	probably benign	Het
Spata18	G	A	5: 73,671,232	V265I	probably benign	Het
Tmem120b	T	A	5: 123,101,642	V108D	possibly damaging	Het
Ugt1a2	T	C	1: 88,201,426	Y264H	probably damaging	Het

Other mutations in Heatr5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Heatr5a	APN	12	51888901	missense	probably damaging	0.99
IGL01397:Heatr5a	APN	12	51894369	missense	possibly damaging	0.89
IGL01481:Heatr5a	APN	12	51955425	missense	probably damaging	1.00
IGL01684:Heatr5a	APN	12	51955511	missense	probably benign	0.36
IGL01766:Heatr5a	APN	12	51889664	missense	probably benign	0.15
IGL01799:Heatr5a	APN	12	51897835	missense	probably benign	0.17
IGL02007:Heatr5a	APN	12	51916158	missense	probably damaging	1.00
IGL02093:Heatr5a	APN	12	51916075	missense	possibly damaging	0.68
IGL02205:Heatr5a	APN	12	51877337	missense	probably damaging	1.00
IGL02450:Heatr5a	APN	12	51945430	missense	probably benign	0.02
IGL02565:Heatr5a	APN	12	51951099	missense	possibly damaging	0.54
IGL02707:Heatr5a	APN	12	51921366	missense	probably benign	0.01
IGL02735:Heatr5a	APN	12	51915021	missense	probably damaging	0.99
IGL03160:Heatr5a	APN	12	51884496	splice site	probably benign
F5770:Heatr5a	UTSW	12	51881278	splice site	probably benign
R0034:Heatr5a	UTSW	12	51925172	missense	probably damaging	1.00
R0127:Heatr5a	UTSW	12	51925405	missense	probably benign
R0184:Heatr5a	UTSW	12	51909969	missense	probably benign	0.00
R0362:Heatr5a	UTSW	12	51888861	missense	probably damaging	1.00
R0567:Heatr5a	UTSW	12	51910089	missense	probably damaging	1.00
R0591:Heatr5a	UTSW	12	51910101	splice site	probably benign
R0736:Heatr5a	UTSW	12	51896561	critical splice donor site	probably null
R1532:Heatr5a	UTSW	12	51952518	missense	probably damaging	0.99
R1914:Heatr5a	UTSW	12	51905467	missense	probably damaging	1.00
R1956:Heatr5a	UTSW	12	51945419	critical splice donor site	probably null
R1978:Heatr5a	UTSW	12	51939658	missense	possibly damaging	0.77
R2044:Heatr5a	UTSW	12	51955403	missense	probably benign	0.19
R2263:Heatr5a	UTSW	12	51916150	missense	probably damaging	0.97
R2265:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2267:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2268:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2269:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2842:Heatr5a	UTSW	12	51955478	missense	probably null	1.00
R2842:Heatr5a	UTSW	12	51955477	splice site	probably null
R3033:Heatr5a	UTSW	12	51951038	nonsense	probably null
R4303:Heatr5a	UTSW	12	51956225	missense	probably benign	0.01
R4675:Heatr5a	UTSW	12	51877347	missense	probably benign	0.17
R4718:Heatr5a	UTSW	12	51916163	missense	possibly damaging	0.95
R4807:Heatr5a	UTSW	12	51877520	missense	probably damaging	1.00
R5114:Heatr5a	UTSW	12	51956237	nonsense	probably null
R5229:Heatr5a	UTSW	12	51947978	missense	probably benign	0.33
R5411:Heatr5a	UTSW	12	51888243	missense	probably damaging	1.00
R5548:Heatr5a	UTSW	12	51958951	nonsense	probably null
R5631:Heatr5a	UTSW	12	51955527	missense	probably benign	0.22
R5742:Heatr5a	UTSW	12	51955552	nonsense	probably null
R5969:Heatr5a	UTSW	12	51959040	missense	probably benign
R6020:Heatr5a	UTSW	12	51884327	missense	probably benign	0.01
R6234:Heatr5a	UTSW	12	51877454	missense	possibly damaging	0.69
R6352:Heatr5a	UTSW	12	51951166	missense	possibly damaging	0.88
R6798:Heatr5a	UTSW	12	51881265	missense	probably benign	0.01
R6815:Heatr5a	UTSW	12	51955508	missense	possibly damaging	0.89
R7059:Heatr5a	UTSW	12	51888234	missense	probably damaging	0.98
R7143:Heatr5a	UTSW	12	51961468	missense	probably benign	0.09
R7178:Heatr5a	UTSW	12	51925142	missense	probably damaging	0.99
R7291:Heatr5a	UTSW	12	51925339	missense	probably damaging	0.97
R7454:Heatr5a	UTSW	12	51961543	missense	probably benign	0.20
R7511:Heatr5a	UTSW	12	51879434	missense	possibly damaging	0.94
R7636:Heatr5a	UTSW	12	51888196	missense	probably damaging	1.00
R7636:Heatr5a	UTSW	12	51952558	missense	probably damaging	1.00
R7665:Heatr5a	UTSW	12	51961530	missense	probably damaging	1.00
R8088:Heatr5a	UTSW	12	51947996	missense	possibly damaging	0.85
R8205:Heatr5a	UTSW	12	51959009	missense	probably benign	0.05
R8212:Heatr5a	UTSW	12	51899229	missense	probably benign	0.00
R8213:Heatr5a	UTSW	12	51891443	missense	probably damaging	0.96
R8323:Heatr5a	UTSW	12	51955506	missense	probably benign	0.02
R8326:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8339:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8395:Heatr5a	UTSW	12	51916178	missense
R8410:Heatr5a	UTSW	12	51938120	missense	probably benign	0.01
R8676:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8834:Heatr5a	UTSW	12	51909956	critical splice donor site	probably null
R8916:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R9057:Heatr5a	UTSW	12	51939637	missense	probably damaging	1.00
R9248:Heatr5a	UTSW	12	51916243	missense
R9287:Heatr5a	UTSW	12	51920477	missense	probably damaging	0.97
R9332:Heatr5a	UTSW	12	51899285	missense	probably benign	0.33
R9454:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R9515:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R9654:Heatr5a	UTSW	12	51958995	missense	probably damaging	1.00
V7732:Heatr5a	UTSW	12	51905324	missense	possibly damaging	0.65
Z1088:Heatr5a	UTSW	12	51891404	missense	probably damaging	1.00
Z1088:Heatr5a	UTSW	12	51951076	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- CCTGATTGCCTTTTACAGCAG -3'
(R):5'- AGACATGTTCTGCAGGCGTG -3'

Sequencing Primer
(F):5'- TTTACAGCAGCCTCCAGCCG -3'
(R):5'- TCTGCAGGCGTGGGTGC -3'

Posted On

2016-10-26