Incidental Mutation 'R5603:Heatr5a'
ID439144
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
MMRRC Submission 043155-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R5603 (G1)
Quality Score150
Status Not validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51877575 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1952 (F1952L)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably benign
Transcript: ENSMUST00000040583
AA Change: F1952L

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: F1952L

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220369
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Baiap2l1 A G 5: 144,265,977 S509P probably damaging Het
Bud31 T C 5: 145,144,959 I52T possibly damaging Het
Cacna1g C T 11: 94,439,752 S979N possibly damaging Het
Cacna2d4 T A 6: 119,244,285 W253R probably damaging Het
Ccna1 A G 3: 55,050,909 Y118H probably damaging Het
Cct8l1 A G 5: 25,516,499 T71A probably benign Het
Chaf1b A G 16: 93,892,795 T19A probably damaging Het
Col6a2 A T 10: 76,596,769 V850D probably damaging Het
Cpsf2 C A 12: 101,998,631 Q513K probably benign Het
Dnah5 T G 15: 28,419,932 V3792G probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Exoc6b T C 6: 84,835,144 D625G possibly damaging Het
Gad1 C A 2: 70,589,829 F352L probably damaging Het
Gm13083 T A 4: 143,617,496 C455* probably null Het
Gm5422 T A 10: 31,250,844 noncoding transcript Het
Grin2b T C 6: 135,923,397 E162G probably damaging Het
Grm6 T A 11: 50,856,959 F333I probably damaging Het
Ighv1-42 C T 12: 114,937,512 probably benign Het
Itgb6 T C 2: 60,620,362 T578A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mfsd14b T C 13: 65,073,606 K291E probably benign Het
Mllt6 T C 11: 97,673,505 L379P probably damaging Het
Mtmr6 A T 14: 60,285,001 K183* probably null Het
Mylk A G 16: 34,956,492 N1345S probably benign Het
Nab2 A T 10: 127,665,121 M1K probably null Het
Ngly1 C A 14: 16,260,762 Q149K probably benign Het
Npy6r T A 18: 44,276,585 S358T probably damaging Het
Pbld2 A G 10: 63,071,449 T156A probably benign Het
Pik3cd A T 4: 149,658,855 C263S probably benign Het
Ptk2b A T 14: 66,172,065 Y507* probably null Het
Rbm25 C T 12: 83,664,216 R368* probably null Het
Rnf207 T C 4: 152,312,394 Y396C probably damaging Het
Skint2 T A 4: 112,649,764 V328E possibly damaging Het
Slc3a2 A G 19: 8,713,728 V7A probably benign Het
Spata18 G A 5: 73,671,232 V265I probably benign Het
Tmem120b T A 5: 123,101,642 V108D possibly damaging Het
Ugt1a2 T C 1: 88,201,426 Y264H probably damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 synonymous probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCTGATTGCCTTTTACAGCAG -3'
(R):5'- AGACATGTTCTGCAGGCGTG -3'

Sequencing Primer
(F):5'- TTTACAGCAGCCTCCAGCCG -3'
(R):5'- TCTGCAGGCGTGGGTGC -3'
Posted On2016-10-26