Incidental Mutation 'R5603:Mfsd14b'
ID439149
Institutional Source Beutler Lab
Gene Symbol Mfsd14b
Ensembl Gene ENSMUSG00000038212
Gene Namemajor facilitator superfamily domain containing 14B
Synonyms5730414C17Rik, Hiatl1
MMRRC Submission 043155-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5603 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65064663-65112975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65073606 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 291 (K291E)
Ref Sequence ENSEMBL: ENSMUSP00000118180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054730] [ENSMUST00000155487]
Predicted Effect probably benign
Transcript: ENSMUST00000054730
AA Change: K291E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000062566
Gene: ENSMUSG00000038212
AA Change: K291E

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.5e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148779
Predicted Effect probably benign
Transcript: ENSMUST00000155487
AA Change: K291E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000118180
Gene: ENSMUSG00000038212
AA Change: K291E

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.6e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Baiap2l1 A G 5: 144,265,977 S509P probably damaging Het
Bud31 T C 5: 145,144,959 I52T possibly damaging Het
Cacna1g C T 11: 94,439,752 S979N possibly damaging Het
Cacna2d4 T A 6: 119,244,285 W253R probably damaging Het
Ccna1 A G 3: 55,050,909 Y118H probably damaging Het
Cct8l1 A G 5: 25,516,499 T71A probably benign Het
Chaf1b A G 16: 93,892,795 T19A probably damaging Het
Col6a2 A T 10: 76,596,769 V850D probably damaging Het
Cpsf2 C A 12: 101,998,631 Q513K probably benign Het
Dnah5 T G 15: 28,419,932 V3792G probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Exoc6b T C 6: 84,835,144 D625G possibly damaging Het
Gad1 C A 2: 70,589,829 F352L probably damaging Het
Gm13083 T A 4: 143,617,496 C455* probably null Het
Gm5422 T A 10: 31,250,844 noncoding transcript Het
Grin2b T C 6: 135,923,397 E162G probably damaging Het
Grm6 T A 11: 50,856,959 F333I probably damaging Het
Heatr5a A G 12: 51,877,575 F1952L probably benign Het
Ighv1-42 C T 12: 114,937,512 probably benign Het
Itgb6 T C 2: 60,620,362 T578A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mllt6 T C 11: 97,673,505 L379P probably damaging Het
Mtmr6 A T 14: 60,285,001 K183* probably null Het
Mylk A G 16: 34,956,492 N1345S probably benign Het
Nab2 A T 10: 127,665,121 M1K probably null Het
Ngly1 C A 14: 16,260,762 Q149K probably benign Het
Npy6r T A 18: 44,276,585 S358T probably damaging Het
Pbld2 A G 10: 63,071,449 T156A probably benign Het
Pik3cd A T 4: 149,658,855 C263S probably benign Het
Ptk2b A T 14: 66,172,065 Y507* probably null Het
Rbm25 C T 12: 83,664,216 R368* probably null Het
Rnf207 T C 4: 152,312,394 Y396C probably damaging Het
Skint2 T A 4: 112,649,764 V328E possibly damaging Het
Slc3a2 A G 19: 8,713,728 V7A probably benign Het
Spata18 G A 5: 73,671,232 V265I probably benign Het
Tmem120b T A 5: 123,101,642 V108D possibly damaging Het
Ugt1a2 T C 1: 88,201,426 Y264H probably damaging Het
Other mutations in Mfsd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Mfsd14b APN 13 65066701 missense probably benign 0.00
IGL01935:Mfsd14b APN 13 65067925 missense probably benign
IGL01957:Mfsd14b APN 13 65087093 missense possibly damaging 0.90
R0555:Mfsd14b UTSW 13 65078445 missense probably benign 0.34
R0601:Mfsd14b UTSW 13 65087150 missense possibly damaging 0.88
R0988:Mfsd14b UTSW 13 65112493 splice site probably benign
R1136:Mfsd14b UTSW 13 65095692 missense probably benign 0.22
R1494:Mfsd14b UTSW 13 65095671 missense probably damaging 1.00
R2087:Mfsd14b UTSW 13 65067982 missense probably damaging 1.00
R4223:Mfsd14b UTSW 13 65066608 utr 3 prime probably benign
R5103:Mfsd14b UTSW 13 65087093 missense possibly damaging 0.56
R5568:Mfsd14b UTSW 13 65072122 splice site probably null
R6181:Mfsd14b UTSW 13 65112584 missense probably benign 0.00
R6330:Mfsd14b UTSW 13 65095686 missense probably damaging 1.00
R6649:Mfsd14b UTSW 13 65066785 missense probably damaging 1.00
R7460:Mfsd14b UTSW 13 65072023 missense probably damaging 1.00
R7605:Mfsd14b UTSW 13 65066777 missense probably benign
X0017:Mfsd14b UTSW 13 65072053 missense probably benign 0.08
X0027:Mfsd14b UTSW 13 65072011 missense probably benign 0.16
X0063:Mfsd14b UTSW 13 65078485 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGAGGCAACAGTTTGGAGG -3'
(R):5'- ATGCTTTCATTGTCTCCAAACTGAC -3'

Sequencing Primer
(F):5'- GGAACTCTTAGAAACTTGTACCCTTG -3'
(R):5'- TCATTGTCTCCAAACTGACATAGAC -3'
Posted On2016-10-26