Incidental Mutation 'R5604:Insig1'
ID439172
Institutional Source Beutler Lab
Gene Symbol Insig1
Ensembl Gene ENSMUSG00000045294
Gene Nameinsulin induced gene 1
Synonyms1810013C12Rik, Insig-1
MMRRC Submission 043156-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location28071363-28078662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28075082 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 224 (L224P)
Ref Sequence ENSEMBL: ENSMUSP00000061877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059155]
Predicted Effect probably damaging
Transcript: ENSMUST00000059155
AA Change: L224P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061877
Gene: ENSMUSG00000045294
AA Change: L224P

DomainStartEndE-ValueType
Pfam:INSIG 68 249 1.1e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199728
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum membrane protein that regulates cholesterol metabolism, lipogenesis, and glucose homeostasis. The encoded protein has six transmembrane helices which contain an effector protein binding site. It binds the sterol-sensing domains of sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) and 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase), and is essential for the sterol-mediated trafficking of these two proteins. It promotes the endoplasmic reticulum retention of SCAP and the ubiquitin-mediated degradation of HMG-CoA reductase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body body weight, increased gonadal and subcutaneous fat pad, decreased circulating triglyceride level and abnormal adipocity differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 V78A probably benign Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Ptch1 T C 13: 63,525,122 K753E probably benign Het
Qrich1 A G 9: 108,559,303 probably null Het
Ror2 G A 13: 53,117,165 R373C probably benign Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Top3b T G 16: 16,889,535 Y526* probably null Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Insig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1607:Insig1 UTSW 5 28071708 missense probably damaging 1.00
R2006:Insig1 UTSW 5 28071466 missense probably benign
R3738:Insig1 UTSW 5 28071703 missense probably damaging 0.99
R6560:Insig1 UTSW 5 28071533 nonsense probably null
R7429:Insig1 UTSW 5 28075079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATTACCATCGCCTTCC -3'
(R):5'- TCTATACATCATAACTTAGGGAGGACC -3'

Sequencing Primer
(F):5'- ATCTCTGAGTTCAAGGTGAGCC -3'
(R):5'- GGAGGACCCAGCTAGATACC -3'
Posted On2016-10-26