Mutagenetix > Incidental Mutations

Incidental Mutation 'R5604:Anapc4'

439173

Institutional Source

Beutler Lab

Gene Symbol

Anapc4

Ensembl Gene

ENSMUSG00000029176

Gene Name

anaphase promoting complex subunit 4

Synonyms

2610306D21Rik, D5Ertd249e, APC4

MMRRC Submission

043156-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5604 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52834012-52867797 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 52841734 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 129 (Y129*)

Ref Sequence

ENSEMBL: ENSMUSP00000031072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]

Predicted Effect

probably null
Transcript: ENSMUST00000031072
AA Change: Y129*

SMART Domains

Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: Y129*

Domain	Start	End	E-Value	Type
Pfam:ANAPC4_WD40	10	57	9.1e-18	PFAM
low complexity region	137	147	N/A	INTRINSIC
Pfam:ANAPC4	232	431	3.7e-61	PFAM
low complexity region	747	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130536

Predicted Effect

probably benign
Transcript: ENSMUST00000144574

SMART Domains

Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

Domain	Start	End	E-Value	Type
Pfam:Apc4_WD40	10	57	4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150682

Predicted Effect

probably benign
Transcript: ENSMUST00000198207

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	A	T	16: 88,759,390	N164I	possibly damaging	Het
4933402J07Rik	C	A	8: 87,568,497	R88S	possibly damaging	Het
Abca1	A	T	4: 53,067,168		probably null	Het
Abca13	T	A	11: 9,566,279	I4406K	probably damaging	Het
Adam6b	T	A	12: 113,490,800	Y412*	probably null	Het
Ahcyl2	C	T	6: 29,908,367	H370Y	probably damaging	Het
Ahi1	A	G	10: 20,987,005	Y693C	probably damaging	Het
Ankrd35	A	G	3: 96,684,899	T834A	probably benign	Het
Antxr2	T	C	5: 97,948,310	K372E	probably damaging	Het
Arhgef1	C	T	7: 24,912,785	H198Y	probably benign	Het
Barhl2	T	C	5: 106,455,546	E249G	probably benign	Het
C2cd5	T	C	6: 143,012,021	E987G	probably benign	Het
C87436	T	C	6: 86,447,355	S290P	probably benign	Het
Ccser1	C	T	6: 61,313,804	T490M	probably damaging	Het
Cd8b1	T	C	6: 71,326,175	V78A	probably benign	Het
Cdc25c	A	G	18: 34,733,648	Y374H	probably damaging	Het
Cmya5	C	T	13: 93,092,763	R1939H	probably benign	Het
Cyp2d40	A	G	15: 82,764,055	F19S	probably damaging	Het
Dll3	A	G	7: 28,294,632	V460A	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
E4f1	A	G	17: 24,444,144	I729T	probably damaging	Het
Endou	A	C	15: 97,720,919	S75A	probably benign	Het
Epas1	C	T	17: 86,805,772	H129Y	probably damaging	Het
Grm1	T	A	10: 10,746,735	N415Y	probably damaging	Het
Hdc	A	T	2: 126,594,663	S429R	probably benign	Het
Hnf4g	C	T	3: 3,657,126	Q447*	probably null	Het
Htr6	C	T	4: 139,061,503	A414T	probably benign	Het
Insig1	T	C	5: 28,075,082	L224P	probably damaging	Het
Ipo9	G	A	1: 135,402,245	L486F	probably damaging	Het
Irak2	T	A	6: 113,690,831	S458T	possibly damaging	Het
Irs2	A	G	8: 11,005,007	S1142P	possibly damaging	Het
Kirrel	T	A	3: 87,089,155	N379I	possibly damaging	Het
L3mbtl4	T	A	17: 68,777,922	D609E	probably benign	Het
Lama3	A	G	18: 12,439,348	T537A	probably benign	Het
Lce1i	A	T	3: 92,777,749	V40E	unknown	Het
Mprip	T	A	11: 59,758,467	V999D	probably benign	Het
Myd88	G	T	9: 119,339,763	T85K	possibly damaging	Het
Olfr395	T	A	11: 73,907,027	H155L	probably benign	Het
Padi6	A	T	4: 140,731,162	M473K	probably damaging	Het
Pcdh12	T	A	18: 38,268,882	S97C	probably damaging	Het
Pkd1l1	T	A	11: 8,833,877	D2026V	probably damaging	Het
Plcxd1	T	C	5: 110,102,585	V264A	probably benign	Het
Plekha4	T	C	7: 45,549,156	S558P	probably damaging	Het
Ppm1a	T	A	12: 72,790,681	M334K	probably benign	Het
Ppp1r13l	T	C	7: 19,375,599	S684P	possibly damaging	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Prl2a1	T	C	13: 27,806,386		probably benign	Het
Ptch1	T	C	13: 63,525,122	K753E	probably benign	Het
Qrich1	A	G	9: 108,559,303		probably null	Het
Ror2	G	A	13: 53,117,165	R373C	probably benign	Het
Rtn4	C	A	11: 29,708,140	L765I	probably damaging	Het
Sema3a	T	C	5: 13,473,520		probably null	Het
Setd2	T	A	9: 110,604,216	D62E	probably damaging	Het
Ss18	A	T	18: 14,636,520	Y327N	unknown	Het
Ticam1	G	A	17: 56,271,756	T113I	probably benign	Het
Tnrc6a	A	G	7: 123,174,236	I1134V	probably damaging	Het
Top3b	T	G	16: 16,889,535	Y526*	probably null	Het
Tph2	T	C	10: 115,090,709	E384G	probably damaging	Het
Ttll11	A	T	2: 35,817,786	I503N	probably benign	Het
Zfp87	T	G	13: 67,517,826	K172N	probably damaging	Het

Other mutations in Anapc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Anapc4	APN	5	52857211	missense	probably damaging	0.98
IGL01066:Anapc4	APN	5	52857209	missense	probably benign	0.08
IGL01109:Anapc4	APN	5	52848628	missense	probably damaging	1.00
IGL01657:Anapc4	APN	5	52864626	nonsense	probably null
IGL02692:Anapc4	APN	5	52864529	missense	probably damaging	0.98
IGL02734:Anapc4	APN	5	52861291	missense	probably benign	0.04
IGL03089:Anapc4	APN	5	52866398	missense	probably benign	0.32
IGL03096:Anapc4	APN	5	52865929	missense	possibly damaging	0.57
FR4304:Anapc4	UTSW	5	52864526	missense	probably damaging	1.00
IGL03048:Anapc4	UTSW	5	52839733	missense	probably benign	0.00
R0331:Anapc4	UTSW	5	52855642	splice site	probably benign
R0511:Anapc4	UTSW	5	52842017	unclassified	probably benign
R0624:Anapc4	UTSW	5	52845419	splice site	probably benign
R0919:Anapc4	UTSW	5	52855637	missense	probably benign	0.18
R1935:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1936:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1942:Anapc4	UTSW	5	52846714	missense	probably benign	0.30
R1953:Anapc4	UTSW	5	52839688	missense	probably damaging	1.00
R1954:Anapc4	UTSW	5	52846625	intron	probably benign
R2341:Anapc4	UTSW	5	52841937	unclassified	probably benign
R3696:Anapc4	UTSW	5	52862009	missense	probably null	0.01
R4506:Anapc4	UTSW	5	52835730	missense	possibly damaging	0.79
R4596:Anapc4	UTSW	5	52841718	missense	probably benign	0.00
R5234:Anapc4	UTSW	5	52848776	missense	probably damaging	1.00
R5256:Anapc4	UTSW	5	52863594	missense	probably benign
R5310:Anapc4	UTSW	5	52859159	missense	probably benign	0.00
R5401:Anapc4	UTSW	5	52863649	missense	probably benign	0.01
R5409:Anapc4	UTSW	5	52848599	missense	probably damaging	0.98
R5525:Anapc4	UTSW	5	52856809	missense	probably damaging	1.00
R5575:Anapc4	UTSW	5	52855871	missense	probably damaging	1.00
R5695:Anapc4	UTSW	5	52862239	missense	probably benign	0.00
R5955:Anapc4	UTSW	5	52865946	missense	probably benign	0.01
R5974:Anapc4	UTSW	5	52845400	missense	probably damaging	1.00
R6458:Anapc4	UTSW	5	52864553	missense	possibly damaging	0.80
R6537:Anapc4	UTSW	5	52843556	missense	probably damaging	0.98
R6633:Anapc4	UTSW	5	52865946	missense	possibly damaging	0.85
R6860:Anapc4	UTSW	5	52848828	missense	probably damaging	1.00
R6965:Anapc4	UTSW	5	52835751	missense	possibly damaging	0.89
R7067:Anapc4	UTSW	5	52862235	missense	probably benign
R7327:Anapc4	UTSW	5	52845330	missense	probably damaging	0.99
R7442:Anapc4	UTSW	5	52857201	missense	probably benign	0.08
R7837:Anapc4	UTSW	5	52859208	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCCAGTGAAACATGCATAC -3'
(R):5'- TGCTGTTGTAACTGGGAGAAAAC -3'

Sequencing Primer
(F):5'- CCAGCGCTTTCTGTTCATATATGGG -3'
(R):5'- AACAGAGAAGGCACACTGG -3'

Posted On

2016-10-26