Incidental Mutation 'R5604:Qrich1'
ID439189
Institutional Source Beutler Lab
Gene Symbol Qrich1
Ensembl Gene ENSMUSG00000006673
Gene Nameglutamine-rich 1
Synonyms2610028H07Rik
MMRRC Submission 043156-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108516806-108560163 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 108559303 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000081111] [ENSMUST00000112155] [ENSMUST00000193421] [ENSMUST00000194904]
Predicted Effect probably null
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081111
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193421
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194387
Predicted Effect probably null
Transcript: ENSMUST00000194904
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195456
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including overriding aorta, double outlet right ventricle with atrioventricular septal defects and ventricular non-compaction, as well as cleft palate, cystic kidneys, and thymus hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 V78A probably benign Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Insig1 T C 5: 28,075,082 L224P probably damaging Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Ptch1 T C 13: 63,525,122 K753E probably benign Het
Ror2 G A 13: 53,117,165 R373C probably benign Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Top3b T G 16: 16,889,535 Y526* probably null Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Qrich1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03136:Qrich1 APN 9 108544918 missense probably damaging 1.00
R0240:Qrich1 UTSW 9 108534134 missense probably damaging 1.00
R0240:Qrich1 UTSW 9 108534134 missense probably damaging 1.00
R0586:Qrich1 UTSW 9 108534520 missense probably damaging 0.98
R0648:Qrich1 UTSW 9 108544877 missense probably damaging 1.00
R1460:Qrich1 UTSW 9 108533647 unclassified probably benign
R1478:Qrich1 UTSW 9 108559332 missense probably benign 0.02
R1631:Qrich1 UTSW 9 108534485 missense probably damaging 0.99
R1964:Qrich1 UTSW 9 108534422 missense possibly damaging 0.92
R1984:Qrich1 UTSW 9 108534047 missense probably damaging 0.99
R2054:Qrich1 UTSW 9 108559270 missense possibly damaging 0.92
R4539:Qrich1 UTSW 9 108534200 missense probably damaging 1.00
R5031:Qrich1 UTSW 9 108541736 missense possibly damaging 0.70
R5353:Qrich1 UTSW 9 108544965 missense probably damaging 1.00
R5510:Qrich1 UTSW 9 108556460 missense possibly damaging 0.69
R5718:Qrich1 UTSW 9 108528823 missense probably damaging 1.00
R5743:Qrich1 UTSW 9 108534115 missense probably damaging 1.00
R5853:Qrich1 UTSW 9 108533608 unclassified probably benign
R6317:Qrich1 UTSW 9 108534292 missense probably damaging 1.00
R6470:Qrich1 UTSW 9 108534518 missense probably damaging 0.98
R6552:Qrich1 UTSW 9 108534305 missense possibly damaging 0.61
R6671:Qrich1 UTSW 9 108533786 missense probably benign 0.03
R6858:Qrich1 UTSW 9 108534134 missense probably damaging 1.00
R7453:Qrich1 UTSW 9 108556476 missense possibly damaging 0.93
R7879:Qrich1 UTSW 9 108559286 missense possibly damaging 0.92
R7925:Qrich1 UTSW 9 108556368 intron probably null
R7962:Qrich1 UTSW 9 108559286 missense possibly damaging 0.92
R8073:Qrich1 UTSW 9 108534428 missense possibly damaging 0.56
Z1177:Qrich1 UTSW 9 108534469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGTAAACAGCTGGAGC -3'
(R):5'- TCTCCTTTAGTGTGAAAGTCTGTC -3'

Sequencing Primer
(F):5'- TCTAGATGCTTATCTGCTGCCAATGG -3'
(R):5'- AAAGTCTGTCTGGTTTTTCCTGGATC -3'
Posted On2016-10-26