Incidental Mutation 'R5604:Ahi1'
ID 439193
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene Name Abelson helper integration site 1
Synonyms 1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
MMRRC Submission 043156-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.871) question?
Stock # R5604 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 20952547-21080429 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20987005 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 693 (Y693C)
Ref Sequence ENSEMBL: ENSMUSP00000149010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000105525
AA Change: Y693C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: Y693C

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213104
AA Change: Y693C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 (GRCm38) N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 (GRCm38) R88S possibly damaging Het
Abca1 A T 4: 53,067,168 (GRCm38) probably null Het
Abca13 T A 11: 9,566,279 (GRCm38) I4406K probably damaging Het
Adam6b T A 12: 113,490,800 (GRCm38) Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 (GRCm38) H370Y probably damaging Het
Anapc4 T A 5: 52,841,734 (GRCm38) Y129* probably null Het
Ankrd35 A G 3: 96,684,899 (GRCm38) T834A probably benign Het
Antxr2 T C 5: 97,948,310 (GRCm38) K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 (GRCm38) H198Y probably benign Het
Barhl2 T C 5: 106,455,546 (GRCm38) E249G probably benign Het
C2cd5 T C 6: 143,012,021 (GRCm38) E987G probably benign Het
C87436 T C 6: 86,447,355 (GRCm38) S290P probably benign Het
Ccser1 C T 6: 61,313,804 (GRCm38) T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 (GRCm38) V78A probably benign Het
Cdc25c A G 18: 34,733,648 (GRCm38) Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 (GRCm38) R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 (GRCm38) F19S probably damaging Het
Dll3 A G 7: 28,294,632 (GRCm38) V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 (GRCm38) probably null Het
E4f1 A G 17: 24,444,144 (GRCm38) I729T probably damaging Het
Endou A C 15: 97,720,919 (GRCm38) S75A probably benign Het
Epas1 C T 17: 86,805,772 (GRCm38) H129Y probably damaging Het
Grm1 T A 10: 10,746,735 (GRCm38) N415Y probably damaging Het
Hdc A T 2: 126,594,663 (GRCm38) S429R probably benign Het
Hnf4g C T 3: 3,657,126 (GRCm38) Q447* probably null Het
Htr6 C T 4: 139,061,503 (GRCm38) A414T probably benign Het
Insig1 T C 5: 28,075,082 (GRCm38) L224P probably damaging Het
Ipo9 G A 1: 135,402,245 (GRCm38) L486F probably damaging Het
Irak2 T A 6: 113,690,831 (GRCm38) S458T possibly damaging Het
Irs2 A G 8: 11,005,007 (GRCm38) S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 (GRCm38) N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 (GRCm38) D609E probably benign Het
Lama3 A G 18: 12,439,348 (GRCm38) T537A probably benign Het
Lce1i A T 3: 92,777,749 (GRCm38) V40E unknown Het
Mprip T A 11: 59,758,467 (GRCm38) V999D probably benign Het
Myd88 G T 9: 119,339,763 (GRCm38) T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 (GRCm38) H155L probably benign Het
Padi6 A T 4: 140,731,162 (GRCm38) M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 (GRCm38) S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 (GRCm38) D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 (GRCm38) V264A probably benign Het
Plekha4 T C 7: 45,549,156 (GRCm38) S558P probably damaging Het
Ppm1a T A 12: 72,790,681 (GRCm38) M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 (GRCm38) S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 (GRCm38) probably null Het
Prl2a1 T C 13: 27,806,386 (GRCm38) probably benign Het
Ptch1 T C 13: 63,525,122 (GRCm38) K753E probably benign Het
Qrich1 A G 9: 108,559,303 (GRCm38) probably benign Het
Ror2 G A 13: 53,117,165 (GRCm38) R373C probably benign Het
Rtn4 C A 11: 29,708,140 (GRCm38) L765I probably damaging Het
Sema3a T C 5: 13,473,520 (GRCm38) probably null Het
Setd2 T A 9: 110,604,216 (GRCm38) D62E probably damaging Het
Ss18 A T 18: 14,636,520 (GRCm38) Y327N unknown Het
Ticam1 G A 17: 56,271,756 (GRCm38) T113I probably benign Het
Tnrc6a A G 7: 123,174,236 (GRCm38) I1134V probably damaging Het
Top3b T G 16: 16,889,535 (GRCm38) Y526* probably null Het
Tph2 T C 10: 115,090,709 (GRCm38) E384G probably damaging Het
Ttll11 A T 2: 35,817,786 (GRCm38) I503N probably benign Het
Zfp87 T G 13: 67,517,826 (GRCm38) K172N probably damaging Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20,972,141 (GRCm38) missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20,984,299 (GRCm38) splice site probably null
IGL01075:Ahi1 APN 10 20,987,025 (GRCm38) missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20,972,060 (GRCm38) missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21,074,433 (GRCm38) missense probably benign
IGL01527:Ahi1 APN 10 20,960,085 (GRCm38) splice site probably benign
IGL01821:Ahi1 APN 10 21,041,243 (GRCm38) critical splice donor site probably null
IGL02159:Ahi1 APN 10 21,058,177 (GRCm38) missense probably benign 0.13
IGL02176:Ahi1 APN 10 20,970,916 (GRCm38) missense probably benign 0.00
IGL02200:Ahi1 APN 10 20,981,314 (GRCm38) splice site probably benign
IGL02232:Ahi1 APN 10 20,981,375 (GRCm38) missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20,970,897 (GRCm38) missense probably benign 0.00
IGL02323:Ahi1 APN 10 20,972,034 (GRCm38) missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21,055,113 (GRCm38) missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20,963,799 (GRCm38) missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21,000,551 (GRCm38) missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20,970,942 (GRCm38) missense probably benign 0.00
IGL03192:Ahi1 APN 10 20,965,635 (GRCm38) missense probably benign 0.00
IGL03377:Ahi1 APN 10 21,018,004 (GRCm38) missense possibly damaging 0.51
arisen UTSW 10 21,007,768 (GRCm38) missense possibly damaging 0.53
urspringt UTSW 10 20,984,393 (GRCm38) missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20,972,110 (GRCm38) missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20,972,110 (GRCm38) missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20,972,075 (GRCm38) missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21,000,719 (GRCm38) splice site probably benign
R0627:Ahi1 UTSW 10 20,965,522 (GRCm38) missense probably benign 0.10
R0652:Ahi1 UTSW 10 20,979,461 (GRCm38) missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20,970,843 (GRCm38) splice site probably benign
R1209:Ahi1 UTSW 10 20,963,730 (GRCm38) missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20,972,156 (GRCm38) missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20,959,800 (GRCm38) missense probably benign 0.00
R1634:Ahi1 UTSW 10 20,965,693 (GRCm38) missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20,963,115 (GRCm38) missense probably benign 0.18
R1818:Ahi1 UTSW 10 20,988,562 (GRCm38) missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20,959,996 (GRCm38) missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20,970,976 (GRCm38) missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20,970,911 (GRCm38) nonsense probably null
R2850:Ahi1 UTSW 10 21,000,593 (GRCm38) missense probably benign 0.07
R2862:Ahi1 UTSW 10 20,981,408 (GRCm38) missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20,959,947 (GRCm38) missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20,972,078 (GRCm38) missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20,965,545 (GRCm38) missense probably benign 0.07
R4755:Ahi1 UTSW 10 21,055,047 (GRCm38) missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20,984,404 (GRCm38) missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20,960,076 (GRCm38) missense probably benign 0.00
R5223:Ahi1 UTSW 10 20,970,919 (GRCm38) missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20,987,022 (GRCm38) missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21,055,047 (GRCm38) missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21,074,427 (GRCm38) missense probably benign
R5769:Ahi1 UTSW 10 20,960,082 (GRCm38) critical splice donor site probably null
R5899:Ahi1 UTSW 10 21,000,566 (GRCm38) missense probably benign 0.06
R5936:Ahi1 UTSW 10 20,965,933 (GRCm38) missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20,984,393 (GRCm38) missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20,959,926 (GRCm38) missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21,058,165 (GRCm38) missense probably benign 0.26
R6135:Ahi1 UTSW 10 20,969,121 (GRCm38) missense probably benign 0.01
R6240:Ahi1 UTSW 10 20,977,081 (GRCm38) missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20,969,043 (GRCm38) missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20,979,592 (GRCm38) missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20,977,049 (GRCm38) missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20,960,082 (GRCm38) critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20,963,673 (GRCm38) missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20,965,567 (GRCm38) missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21,017,913 (GRCm38) missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21,055,069 (GRCm38) missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20,963,691 (GRCm38) missense probably benign 0.02
R6967:Ahi1 UTSW 10 20,988,625 (GRCm38) missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21,017,932 (GRCm38) missense probably benign 0.01
R7169:Ahi1 UTSW 10 21,055,019 (GRCm38) missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20,987,077 (GRCm38) missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20,965,933 (GRCm38) missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20,963,750 (GRCm38) missense probably benign 0.35
R7680:Ahi1 UTSW 10 21,007,768 (GRCm38) missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20,981,431 (GRCm38) critical splice donor site probably null
R7999:Ahi1 UTSW 10 20,965,681 (GRCm38) missense probably benign 0.31
R8219:Ahi1 UTSW 10 21,074,436 (GRCm38) missense probably benign 0.00
R8248:Ahi1 UTSW 10 20,972,092 (GRCm38) missense probably benign 0.04
R8560:Ahi1 UTSW 10 20,959,915 (GRCm38) missense probably benign 0.04
R8926:Ahi1 UTSW 10 21,055,083 (GRCm38) missense probably damaging 1.00
R8965:Ahi1 UTSW 10 20,963,862 (GRCm38) missense probably benign
R8987:Ahi1 UTSW 10 20,963,784 (GRCm38) missense probably damaging 1.00
R9013:Ahi1 UTSW 10 21,007,759 (GRCm38) missense probably benign 0.28
R9145:Ahi1 UTSW 10 21,000,589 (GRCm38) missense probably benign 0.01
R9365:Ahi1 UTSW 10 20,972,136 (GRCm38) missense probably damaging 0.99
R9567:Ahi1 UTSW 10 20,981,401 (GRCm38) missense possibly damaging 0.95
X0024:Ahi1 UTSW 10 21,000,592 (GRCm38) missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 21,041,007 (GRCm38) intron probably benign
Predicted Primers PCR Primer
(F):5'- GAGACAATGTCAGCTGTTGC -3'
(R):5'- AAAGTGTAGTTGTCACATACGCTG -3'

Sequencing Primer
(F):5'- GCTGTTGCTAAATGAGAAAGTCTAC -3'
(R):5'- GTAGTTGTCACATACGCTGAACTTTC -3'
Posted On 2016-10-26