Incidental Mutation 'R5604:Pkd1l1'
ID439197
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
MMRRC Submission 043156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8833877 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 2026 (D2026V)
Ref Sequence ENSEMBL: ENSMUSP00000136518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect unknown
Transcript: ENSMUST00000154153
AA Change: D2476V
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: D2476V

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178195
AA Change: D2026V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: D2026V

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 V78A probably benign Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Insig1 T C 5: 28,075,082 L224P probably damaging Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Ptch1 T C 13: 63,525,122 K753E probably benign Het
Qrich1 A G 9: 108,559,303 probably benign Het
Ror2 G A 13: 53,117,165 R373C probably benign Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Top3b T G 16: 16,889,535 Y526* probably null Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
R7699:Pkd1l1 UTSW 11 8965142 missense
R7922:Pkd1l1 UTSW 11 8849013 missense
R7922:Pkd1l1 UTSW 11 8909857 missense
R7980:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R7993:Pkd1l1 UTSW 11 8945262 missense
R8052:Pkd1l1 UTSW 11 8947315 missense
R8125:Pkd1l1 UTSW 11 8947241 missense probably damaging 1.00
R8420:Pkd1l1 UTSW 11 8870277 nonsense probably null
R8675:Pkd1l1 UTSW 11 8848916 critical splice donor site probably null
R8683:Pkd1l1 UTSW 11 8871805 missense
R8709:Pkd1l1 UTSW 11 8855567 missense
R8711:Pkd1l1 UTSW 11 8865550 missense
R8725:Pkd1l1 UTSW 11 8961482 missense
R8733:Pkd1l1 UTSW 11 8933657 missense
R8822:Pkd1l1 UTSW 11 8856312 missense
R8871:Pkd1l1 UTSW 11 8950503 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- TAATCAATTCTGGCCGGAGCAC -3'
(R):5'- GTAACTTCTGGGTCCAGGATG -3'

Sequencing Primer
(F):5'- TGGCCGGAGCACATCTTTC -3'
(R):5'- CTTCTGGGTCCAGGATGTTTTATAAC -3'
Posted On2016-10-26