Incidental Mutation 'R5604:Ror2'
ID439206
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Namereceptor tyrosine kinase-like orphan receptor 2
SynonymsNtrkr2
MMRRC Submission 043156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location53109312-53286124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53117165 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 373 (R373C)
Ref Sequence ENSEMBL: ENSMUSP00000123362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
Predicted Effect probably benign
Transcript: ENSMUST00000021918
AA Change: R385C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: R385C

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130235
AA Change: R373C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: R373C

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 V78A probably benign Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Insig1 T C 5: 28,075,082 L224P probably damaging Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Ptch1 T C 13: 63,525,122 K753E probably benign Het
Qrich1 A G 9: 108,559,303 probably null Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Top3b T G 16: 16,889,535 Y526* probably null Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCAGTCAGACTTTTCTTAG -3'
(R):5'- ATGGCCAGTACCACCAAGTC -3'

Sequencing Primer
(F):5'- GCTTAAAACATCCCATGATAATCTGC -3'
(R):5'- AAGTCAGGCCACCAGTGTCAG -3'
Posted On2016-10-26