Incidental Mutation 'R5604:Ptch1'
ID439207
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission 043156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63525122 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 753 (K753E)
Ref Sequence ENSEMBL: ENSMUSP00000141489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: K890E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: K890E

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: K753E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: K753E

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 V78A probably benign Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Insig1 T C 5: 28,075,082 L224P probably damaging Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Qrich1 A G 9: 108,559,303 probably null Het
Ror2 G A 13: 53,117,165 R373C probably benign Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Top3b T G 16: 16,889,535 Y526* probably null Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGGATGGGAGTGCTACTTAC -3'
(R):5'- ACACTGGTGATTGCATCCCC -3'

Sequencing Primer
(F):5'- ATGGGAGTGCTACTTACTTCTCAGC -3'
(R):5'- GGTGATTGCATCCCCCAATAAGTG -3'
Posted On2016-10-26