Incidental Mutation 'R5604:Top3b'
ID439212
Institutional Source Beutler Lab
Gene Symbol Top3b
Ensembl Gene ENSMUSG00000022779
Gene Nametopoisomerase (DNA) III beta
SynonymsTopo III beta
MMRRC Submission 043156-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16870736-16892990 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 16889535 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 526 (Y526*)
Ref Sequence ENSEMBL: ENSMUSP00000156132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000119787] [ENSMUST00000232080] [ENSMUST00000232581]
Predicted Effect probably null
Transcript: ENSMUST00000023465
AA Change: Y526*
SMART Domains Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779
AA Change: Y526*

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118424
Predicted Effect probably null
Transcript: ENSMUST00000119787
AA Change: Y526*
SMART Domains Protein: ENSMUSP00000112913
Gene: ENSMUSG00000022779
AA Change: Y526*

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151271
Predicted Effect probably null
Transcript: ENSMUST00000156951
AA Change: Y320*
SMART Domains Protein: ENSMUSP00000115214
Gene: ENSMUSG00000022779
AA Change: Y320*

DomainStartEndE-ValueType
TOP1Ac 84 340 2.28e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231834
Predicted Effect probably benign
Transcript: ENSMUST00000231966
Predicted Effect probably benign
Transcript: ENSMUST00000232080
Predicted Effect probably null
Transcript: ENSMUST00000232117
AA Change: Y320*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232531
Predicted Effect probably null
Transcript: ENSMUST00000232581
AA Change: Y526*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232656
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice develop to maturity but die prematurely showing enlargement of lymphatic organs and glomerulonephritis. Intercrossing of mutant mice progressively results in infertility that is correlated to increased aneuploidy in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 V78A probably benign Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Insig1 T C 5: 28,075,082 L224P probably damaging Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Ptch1 T C 13: 63,525,122 K753E probably benign Het
Qrich1 A G 9: 108,559,303 probably null Het
Ror2 G A 13: 53,117,165 R373C probably benign Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Top3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Top3b APN 16 16887622 missense probably damaging 0.97
IGL01512:Top3b APN 16 16891422 missense possibly damaging 0.74
IGL01552:Top3b APN 16 16887823 splice site probably benign
IGL01738:Top3b APN 16 16880604 missense probably benign 0.04
IGL02090:Top3b APN 16 16891470 missense possibly damaging 0.81
R0143:Top3b UTSW 16 16883525 missense probably damaging 0.97
R0883:Top3b UTSW 16 16879437 splice site probably benign
R1386:Top3b UTSW 16 16880629 missense probably benign 0.29
R1440:Top3b UTSW 16 16892777 nonsense probably null
R1958:Top3b UTSW 16 16884302 missense possibly damaging 0.52
R1970:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4211:Top3b UTSW 16 16882532 unclassified probably null
R4292:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4307:Top3b UTSW 16 16889617 splice site probably benign
R4832:Top3b UTSW 16 16890662 nonsense probably null
R5047:Top3b UTSW 16 16891418 missense probably benign 0.00
R5364:Top3b UTSW 16 16886970 missense probably benign 0.00
R5590:Top3b UTSW 16 16891577 intron probably benign
R5719:Top3b UTSW 16 16885836 missense probably damaging 1.00
R5969:Top3b UTSW 16 16883565 critical splice donor site probably null
R6018:Top3b UTSW 16 16892892 missense probably damaging 1.00
R6144:Top3b UTSW 16 16879141 unclassified probably null
R6155:Top3b UTSW 16 16891509 missense probably damaging 1.00
R6341:Top3b UTSW 16 16879071 missense probably damaging 0.98
R6700:Top3b UTSW 16 16892669 missense possibly damaging 0.48
R7417:Top3b UTSW 16 16877850 start gained probably benign
R7586:Top3b UTSW 16 16891368 missense probably benign 0.44
R7747:Top3b UTSW 16 16887721 missense probably benign 0.17
X0011:Top3b UTSW 16 16890189 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGTCTGGACCTAATGAGC -3'
(R):5'- CATCTCTGCAGTGGGGATTG -3'

Sequencing Primer
(F):5'- CAAAATAAGCTTCAGGTTGTGGCAC -3'
(R):5'- TGGGGATTGGGGAAATGCATG -3'
Posted On2016-10-26