Incidental Mutation 'R5605:Ncstn'
ID439225
Institutional Source Beutler Lab
Gene Symbol Ncstn
Ensembl Gene ENSMUSG00000003458
Gene Namenicastrin
SynonymsNct, nicastrin, D1Dau13e, 9430068N19Rik
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172066013-172082795 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 172081150 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000027833] [ENSMUST00000124289] [ENSMUST00000135192] [ENSMUST00000140643] [ENSMUST00000146137]
Predicted Effect probably benign
Transcript: ENSMUST00000003550
SMART Domains Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Peptidase_M28 254 468 2.9e-7 PFAM
Pfam:Nicastrin 273 498 1.6e-94 PFAM
transmembrane domain 669 691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027833
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124289
SMART Domains Protein: ENSMUSP00000118899
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
Blast:WD40 1 37 2e-19 BLAST
PDB:4J8G|B 1 52 2e-23 PDB
SCOP:d1erja_ 1 52 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126634
Predicted Effect probably benign
Transcript: ENSMUST00000135192
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138407
Predicted Effect probably benign
Transcript: ENSMUST00000140643
SMART Domains Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142825
Predicted Effect probably benign
Transcript: ENSMUST00000146137
SMART Domains Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Ncstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Ncstn APN 1 172074401 missense probably benign 0.02
IGL02030:Ncstn APN 1 172072457 splice site probably benign
IGL02470:Ncstn APN 1 172082599 critical splice donor site probably null
IGL02498:Ncstn APN 1 172068592 missense probably benign
Pig UTSW 1 172071525 missense probably damaging 1.00
truffle UTSW 1 172070009 missense probably damaging 1.00
R0048:Ncstn UTSW 1 172069961 splice site probably benign
R0480:Ncstn UTSW 1 172082592 splice site probably benign
R0648:Ncstn UTSW 1 172067887 missense probably benign 0.01
R0792:Ncstn UTSW 1 172071505 missense possibly damaging 0.95
R1330:Ncstn UTSW 1 172071525 missense probably damaging 1.00
R1524:Ncstn UTSW 1 172072149 missense possibly damaging 0.58
R1660:Ncstn UTSW 1 172066772 missense possibly damaging 0.78
R1828:Ncstn UTSW 1 172071471 frame shift probably null
R1892:Ncstn UTSW 1 172071471 frame shift probably null
R1907:Ncstn UTSW 1 172072143 missense probably damaging 0.97
R3722:Ncstn UTSW 1 172067895 missense possibly damaging 0.50
R3876:Ncstn UTSW 1 172070073 missense probably benign 0.02
R3946:Ncstn UTSW 1 172067494 missense probably benign 0.00
R3969:Ncstn UTSW 1 172070009 missense probably damaging 1.00
R4108:Ncstn UTSW 1 172072544 missense probably damaging 1.00
R4597:Ncstn UTSW 1 172068256 nonsense probably null
R4998:Ncstn UTSW 1 172071520 missense possibly damaging 0.81
R5037:Ncstn UTSW 1 172068626 missense probably damaging 1.00
R5150:Ncstn UTSW 1 172067584 intron probably benign
R5406:Ncstn UTSW 1 172072164 missense probably benign 0.00
R5444:Ncstn UTSW 1 172072839 missense possibly damaging 0.92
R6675:Ncstn UTSW 1 172071528 missense probably damaging 1.00
R7268:Ncstn UTSW 1 172081263 missense possibly damaging 0.86
R7290:Ncstn UTSW 1 172072806 missense probably benign
R7871:Ncstn UTSW 1 172075456 missense probably benign 0.00
R7954:Ncstn UTSW 1 172075456 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATCCCACCAGGTTCAGATC -3'
(R):5'- CTGTTTATCTTCTGATCAGGATTGTG -3'

Sequencing Primer
(F):5'- TCCTGCTGGGAAAGTTAATCC -3'
(R):5'- ATCAGGATTGTGTGGGGGAAACTC -3'
Posted On2016-10-26