Incidental Mutation 'R5605:Npdc1'
ID439226
Institutional Source Beutler Lab
Gene Symbol Npdc1
Ensembl Gene ENSMUSG00000015094
Gene Nameneural proliferation, differentiation and control 1
SynonymsNPDC-1
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25399351-25409494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25408945 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 284 (D284N)
Ref Sequence ENSEMBL: ENSMUSP00000071387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055921] [ENSMUST00000071442] [ENSMUST00000133409] [ENSMUST00000141567] [ENSMUST00000154809]
Predicted Effect probably damaging
Transcript: ENSMUST00000055921
AA Change: D293N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049602
Gene: ENSMUSG00000015094
AA Change: D293N

DomainStartEndE-ValueType
Pfam:NPDC1 1 341 9.1e-234 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071442
AA Change: D284N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071387
Gene: ENSMUSG00000015094
AA Change: D284N

DomainStartEndE-ValueType
Pfam:NPDC1 1 332 7.2e-217 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132287
Predicted Effect possibly damaging
Transcript: ENSMUST00000133409
AA Change: D226N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117773
Gene: ENSMUSG00000015094
AA Change: D226N

DomainStartEndE-ValueType
Pfam:NPDC1 1 274 3.4e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141106
Predicted Effect probably benign
Transcript: ENSMUST00000141567
SMART Domains Protein: ENSMUSP00000116275
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 231 7.8e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144413
Predicted Effect probably benign
Transcript: ENSMUST00000154809
SMART Domains Protein: ENSMUSP00000123386
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 142 1.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156824
Meta Mutation Damage Score 0.5505 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Homozygous null mice display no obvious abnormalities in viability, fertility, behavior, or brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Npdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Npdc1 APN 2 25407637 missense possibly damaging 0.61
IGL02023:Npdc1 APN 2 25408020 unclassified probably benign
IGL02894:Npdc1 APN 2 25407995 missense probably benign 0.04
danke UTSW 2 25406245 missense probably damaging 1.00
R0650:Npdc1 UTSW 2 25408009 missense probably benign 0.16
R1136:Npdc1 UTSW 2 25407715 missense probably benign 0.09
R4008:Npdc1 UTSW 2 25408980 nonsense probably null
R4724:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R4725:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R4726:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R4728:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R4836:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R4843:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R4882:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R5108:Npdc1 UTSW 2 25408655 missense probably damaging 1.00
R5393:Npdc1 UTSW 2 25408670 missense probably damaging 1.00
R5572:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R5573:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R5574:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R5630:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R5632:Npdc1 UTSW 2 25408945 missense probably damaging 1.00
R5655:Npdc1 UTSW 2 25407680 missense possibly damaging 0.71
R6823:Npdc1 UTSW 2 25409109 missense probably damaging 1.00
R7151:Npdc1 UTSW 2 25409108 missense probably damaging 0.98
R7400:Npdc1 UTSW 2 25406245 missense probably damaging 1.00
R8777:Npdc1 UTSW 2 25408117 missense probably damaging 0.98
R8777-TAIL:Npdc1 UTSW 2 25408117 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTGGCCGCTTTTCTCCTG -3'
(R):5'- ATGGTCAAACAGTGGGTTGCG -3'

Sequencing Primer
(F):5'- GTCCCTACCTGCTCGAAAC -3'
(R):5'- TGGGTTGCGCACCTCCATC -3'
Posted On2016-10-26