Mutagenetix > Incidental Mutations

Incidental Mutation 'R5605:Catsper2'

439228

Institutional Source

Beutler Lab

Gene Symbol

Catsper2

Ensembl Gene

ENSMUSG00000033486

Gene Name

cation channel, sperm associated 2

Synonyms

MMRRC Submission

043270-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5605 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121392631-121413792 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121397052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 546 (R546C)

Ref Sequence

ENSEMBL: ENSMUSP00000037222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038073] [ENSMUST00000154604]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038073
AA Change: R546C

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000037222
Gene: ENSMUSG00000033486
AA Change: R546C

Domain	Start	End	E-Value	Type
low complexity region	78	91	N/A	INTRINSIC
Pfam:Ion_trans	105	350	1e-35	PFAM
low complexity region	422	447	N/A	INTRINSIC
internal_repeat_1	450	473	3.72e-11	PROSPERO
internal_repeat_1	465	488	3.72e-11	PROSPERO
low complexity region	491	502	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118847

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146521

Predicted Effect

probably benign
Transcript: ENSMUST00000154604

SMART Domains

Protein: ENSMUSP00000119091
Gene: ENSMUSG00000033486

Domain	Start	End	E-Value	Type
low complexity region	78	91	N/A	INTRINSIC

Meta Mutation Damage Score

0.2307

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. This gene is part of a tandem repeat on chromosome 15q15; the second copy of this gene is thought to be a pseudogene. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null male mice are infertile due to a sperm motility defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	C	A	18: 67,442,355	G83*	probably null	Het
Arap2	A	T	5: 62,615,067	M1476K	possibly damaging	Het
Ccdc109b	T	C	3: 129,917,009	E258G	probably damaging	Het
Ceacam5	T	C	7: 17,747,236	F303L	probably benign	Het
Clvs1	A	G	4: 9,281,751	D65G	probably damaging	Het
Coq5	T	C	5: 115,283,717		probably null	Het
D630045J12Rik	A	T	6: 38,191,764	V950E	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dnah7c	A	G	1: 46,798,235	D3936G	possibly damaging	Het
Doc2b	T	C	11: 75,771,960	E404G	probably damaging	Het
Dsg1b	C	T	18: 20,399,539	P547S	probably benign	Het
Erich6	A	G	3: 58,625,119	Y356H	probably damaging	Het
Galnt6	C	T	15: 100,697,225	R465Q	probably damaging	Het
Gbp5	T	C	3: 142,501,276	S69P	probably damaging	Het
Gdpd4	T	C	7: 98,006,300	V562A	probably benign	Het
Gm2075	T	A	12: 88,011,998	C51S	probably damaging	Het
Gm340	T	A	19: 41,582,863	I165N	probably damaging	Het
Greb1	A	T	12: 16,708,726	V663D	probably damaging	Het
Gtf3c3	A	T	1: 54,415,926	S593T	probably benign	Het
H2-Eb1	T	C	17: 34,309,833	S113P	probably benign	Het
Herc3	C	T	6: 58,857,727	R240C	probably damaging	Het
Iqub	T	C	6: 24,505,621	D96G	probably benign	Het
Kcnt2	A	T	1: 140,574,743	E858D	possibly damaging	Het
Lrp2	C	T	2: 69,523,299	R539K	probably damaging	Het
Lrrc10	C	A	10: 117,045,900	P160T	probably damaging	Het
Map3k12	G	T	15: 102,503,865	D280E	probably benign	Het
Mdn1	T	C	4: 32,765,664	S5208P	probably benign	Het
Med20	C	A	17: 47,623,144		probably benign	Het
Mertk	T	C	2: 128,738,307	V227A	probably benign	Het
Mrvi1	C	T	7: 110,946,002	C29Y	possibly damaging	Het
Ncstn	A	G	1: 172,081,150		probably benign	Het
Nedd4l	T	C	18: 65,174,244		probably null	Het
Nfyc	A	G	4: 120,790,489		probably benign	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Nt5dc1	C	T	10: 34,403,695	C117Y	probably benign	Het
Nup88	A	T	11: 70,944,070		probably benign	Het
Olfr5	C	T	7: 6,480,326	V277M	probably benign	Het
Pbrm1	T	A	14: 31,035,992	I193K	probably benign	Het
Pcsk2	T	C	2: 143,749,245		probably benign	Het
Pdzd2	A	T	15: 12,592,350	C69*	probably null	Het
Polr1e	A	G	4: 45,018,723	T18A	probably benign	Het
Prima1	T	A	12: 103,199,904	I124F	probably benign	Het
Rbm34	T	C	8: 126,949,419	K382R	probably benign	Het
Rftn1	T	G	17: 50,047,407	N309T	probably damaging	Het
Sept1	C	T	7: 127,215,426	D260N	probably damaging	Het
Serpina3g	T	C	12: 104,241,040	V154A	probably damaging	Het
Spef2	A	T	15: 9,609,520	N1306K	probably damaging	Het
Stk4	T	C	2: 164,079,566	F29S	probably damaging	Het
Stxbp5	A	G	10: 9,769,746		probably benign	Het
Tbl3	T	C	17: 24,700,759	T774A	probably benign	Het
Tinag	A	G	9: 77,045,412	Y97H	probably damaging	Het
Tpm1	T	C	9: 67,049,035	E33G	probably damaging	Het
Usp17lb	T	C	7: 104,840,640	E359G	probably benign	Het
Vmn2r91	A	G	17: 18,136,501	E810G	probably damaging	Het
Vwce	A	T	19: 10,658,038	T633S	possibly damaging	Het
Ylpm1	G	A	12: 85,028,853	R326H	probably damaging	Het

Other mutations in Catsper2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Catsper2	APN	2	121397892	splice site	probably benign
IGL01830:Catsper2	APN	2	121407362	missense	probably damaging	1.00
IGL03243:Catsper2	APN	2	121406819	missense	probably benign	0.08
IGL03247:Catsper2	APN	2	121410200	missense	probably benign	0.03
IGL03342:Catsper2	APN	2	121406736	missense	probably damaging	0.99
FR4304:Catsper2	UTSW	2	121397542	nonsense	probably null
FR4304:Catsper2	UTSW	2	121397782	utr 3 prime	probably benign
FR4342:Catsper2	UTSW	2	121397793	utr 3 prime	probably benign
FR4589:Catsper2	UTSW	2	121397779	utr 3 prime	probably benign
FR4737:Catsper2	UTSW	2	121397540	utr 3 prime	probably benign
FR4976:Catsper2	UTSW	2	121397542	utr 3 prime	probably benign
FR4976:Catsper2	UTSW	2	121397779	utr 3 prime	probably benign
FR4976:Catsper2	UTSW	2	121397782	utr 3 prime	probably benign
FR4976:Catsper2	UTSW	2	121397795	utr 3 prime	probably benign
R1463:Catsper2	UTSW	2	121406446	missense	probably damaging	1.00
R1686:Catsper2	UTSW	2	121400042	critical splice donor site	probably null
R2006:Catsper2	UTSW	2	121406357	nonsense	probably null
R2163:Catsper2	UTSW	2	121400175	missense	probably damaging	1.00
R4543:Catsper2	UTSW	2	121407409	nonsense	probably null
R4888:Catsper2	UTSW	2	121397123	splice site	probably null
R5121:Catsper2	UTSW	2	121397123	splice site	probably null
R5323:Catsper2	UTSW	2	121406735	missense	probably damaging	1.00
R5518:Catsper2	UTSW	2	121406363	missense	possibly damaging	0.69
R6521:Catsper2	UTSW	2	121406807	missense	probably damaging	1.00
R6531:Catsper2	UTSW	2	121399780	missense	possibly damaging	0.67
R7055:Catsper2	UTSW	2	121397572	utr 3 prime	probably benign
R7138:Catsper2	UTSW	2	121397063	missense	possibly damaging	0.85
R7240:Catsper2	UTSW	2	121397572	utr 3 prime	probably benign
R7247:Catsper2	UTSW	2	121397572	utr 3 prime	probably benign
R7686:Catsper2	UTSW	2	121397456	splice site	probably null
R8385:Catsper2	UTSW	2	121410140	missense	possibly damaging	0.46
R8426:Catsper2	UTSW	2	121397572	utr 3 prime	probably benign
R9086:Catsper2	UTSW	2	121397572	utr 3 prime	probably benign
R9284:Catsper2	UTSW	2	121397572	utr 3 prime	probably benign
R9327:Catsper2	UTSW	2	121397572	utr 3 prime	probably benign
RF028:Catsper2	UTSW	2	121397726	utr 3 prime	probably benign
Z1176:Catsper2	UTSW	2	121407385	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ATTGAGACAGAGATGCTACGTC -3'
(R):5'- TGCTGCAAATTCTGGCAGTG -3'

Sequencing Primer
(F):5'- GAGACAGAGATGCTACGTCCTTATAC -3'
(R):5'- TCTGTAGACTTACACTGTAGCCCAAG -3'

Posted On

2016-10-26