Incidental Mutation 'R5605:Gbp5'
ID439235
Institutional Source Beutler Lab
Gene Symbol Gbp5
Ensembl Gene ENSMUSG00000105504
Gene Nameguanylate binding protein 5
Synonyms5330409J06Rik, Gbp5a
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5605 (G1)
Quality Score205
Status Validated
Chromosome3
Chromosomal Location142493978-142522344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142501276 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 69 (S69P)
Ref Sequence ENSEMBL: ENSMUSP00000143336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090127] [ENSMUST00000196255] [ENSMUST00000197459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090127
AA Change: S69P

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087587
Gene: ENSMUSG00000105504
AA Change: S69P

DomainStartEndE-ValueType
Pfam:GBP 18 281 4e-113 PFAM
Pfam:GBP_C 283 575 6e-109 PFAM
low complexity region 579 585 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196255
AA Change: S69P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143336
Gene: ENSMUSG00000105504
AA Change: S69P

DomainStartEndE-ValueType
Pfam:GBP 18 281 2.8e-113 PFAM
Pfam:GBP_C 283 556 5.5e-106 PFAM
internal_repeat_1 579 640 3.01e-21 PROSPERO
internal_repeat_1 647 708 3.01e-21 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000197459
SMART Domains Protein: ENSMUSP00000142938
Gene: ENSMUSG00000105504

DomainStartEndE-ValueType
Pfam:GBP 18 65 4.7e-16 PFAM
Pfam:GBP 63 169 4.8e-33 PFAM
Pfam:GBP_C 171 444 9.3e-104 PFAM
internal_repeat_1 467 528 5.89e-22 PROSPERO
internal_repeat_1 535 596 5.89e-22 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199578
Meta Mutation Damage Score 0.5528 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The encoded protein acts as an activator of NLRP3 inflammasome assembly and has a role in innate immunity and inflammation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Listeria infection and NLRP3 inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Gbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Gbp5 APN 3 142500594 missense probably damaging 1.00
IGL01625:Gbp5 APN 3 142503028 missense probably damaging 0.98
IGL02294:Gbp5 APN 3 142503827 missense probably damaging 1.00
PIT4362001:Gbp5 UTSW 3 142500710 missense probably damaging 1.00
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0166:Gbp5 UTSW 3 142506919 critical splice donor site probably null
R0357:Gbp5 UTSW 3 142505411 missense probably benign 0.05
R0414:Gbp5 UTSW 3 142507913 critical splice acceptor site probably null
R0457:Gbp5 UTSW 3 142507757 missense probably damaging 1.00
R0959:Gbp5 UTSW 3 142503124 missense possibly damaging 0.47
R1520:Gbp5 UTSW 3 142508014 missense probably damaging 0.97
R2143:Gbp5 UTSW 3 142503832 missense probably damaging 1.00
R2369:Gbp5 UTSW 3 142500719 missense possibly damaging 0.54
R3155:Gbp5 UTSW 3 142503127 critical splice donor site probably null
R4602:Gbp5 UTSW 3 142503785 missense probably benign 0.06
R4770:Gbp5 UTSW 3 142508076 missense possibly damaging 0.75
R5096:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R7066:Gbp5 UTSW 3 142507729 missense probably benign 0.00
R7234:Gbp5 UTSW 3 142521137 missense probably benign 0.00
R7237:Gbp5 UTSW 3 142507700 missense probably benign 0.41
R7258:Gbp5 UTSW 3 142506781 missense probably damaging 1.00
R7475:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R7521:Gbp5 UTSW 3 142500621 missense probably benign 0.06
R7627:Gbp5 UTSW 3 142500558 start codon destroyed probably null 1.00
R7788:Gbp5 UTSW 3 142503080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATCCCAACTTTCAGTCCTTAG -3'
(R):5'- ACCAATTCAACTGGTGGTGAG -3'

Sequencing Primer
(F):5'- AGTATTATTTTCCCATTCCTCTGCG -3'
(R):5'- TGGTGAGAAGGGAAATTCCTGC -3'
Posted On2016-10-26