Incidental Mutation 'R5605:Olfr5'
ID439243
Institutional Source Beutler Lab
Gene Symbol Olfr5
Ensembl Gene ENSMUSG00000096228
Gene Nameolfactory receptor 5
SynonymsMOR103-8, GA_x6K02T2QGBW-3210997-3210059
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6478322-6486941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6480326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 277 (V277M)
Ref Sequence ENSEMBL: ENSMUSP00000147586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086318] [ENSMUST00000207658] [ENSMUST00000209866] [ENSMUST00000215302]
Predicted Effect probably benign
Transcript: ENSMUST00000086318
AA Change: V277M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000083498
Gene: ENSMUSG00000096228
AA Change: V277M

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.1e-50 PFAM
Pfam:7tm_1 45 294 6.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207658
Predicted Effect probably benign
Transcript: ENSMUST00000209866
AA Change: V277M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000215302
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Olfr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr5 APN 7 6480998 missense probably benign
IGL02174:Olfr5 APN 7 6480439 missense probably benign
IGL03260:Olfr5 APN 7 6480659 missense probably damaging 0.99
IGL03411:Olfr5 APN 7 6480436 missense probably benign 0.26
R1186:Olfr5 UTSW 7 6480542 missense probably benign 0.00
R1381:Olfr5 UTSW 7 6481009 splice site probably null
R1981:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R1982:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R3876:Olfr5 UTSW 7 6481132 missense probably benign 0.01
R3907:Olfr5 UTSW 7 6480679 missense probably damaging 1.00
R4422:Olfr5 UTSW 7 6481038 nonsense probably null
R4654:Olfr5 UTSW 7 6481046 missense probably benign 0.00
R6962:Olfr5 UTSW 7 6481009 missense probably benign 0.07
R7524:Olfr5 UTSW 7 6480587 missense probably benign 0.04
R7576:Olfr5 UTSW 7 6480331 missense probably damaging 0.97
R8306:Olfr5 UTSW 7 6480869 missense possibly damaging 0.83
Z1177:Olfr5 UTSW 7 6480873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCATTAGACCAAAGATTTCCC -3'
(R):5'- CCTCCTATGTGGCTATTGGC -3'

Sequencing Primer
(F):5'- ATTGAACCCTGGTGATGCC -3'
(R):5'- GCTATTGGCAGGGCAGTTC -3'
Posted On2016-10-26