Incidental Mutation 'R5605:Usp17lb'
ID439246
Institutional Source Beutler Lab
Gene Symbol Usp17lb
Ensembl Gene ENSMUSG00000062369
Gene Nameubiquitin specific peptidase 17-like B
Synonyms
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104840257-104842603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104840640 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 359 (E359G)
Ref Sequence ENSEMBL: ENSMUSP00000102427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076501] [ENSMUST00000106814]
Predicted Effect probably benign
Transcript: ENSMUST00000076501
AA Change: E360G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075822
Gene: ENSMUSG00000062369
AA Change: E360G

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.2e-55 PFAM
Pfam:UCH_1 51 327 6.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106814
AA Change: E359G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102427
Gene: ENSMUSG00000062369
AA Change: E359G

DomainStartEndE-ValueType
Pfam:UCH 49 344 2.3e-61 PFAM
Pfam:UCH_1 50 326 1.5e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Usp17lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Usp17lb APN 7 104841229 missense probably damaging 0.98
IGL01571:Usp17lb APN 7 104840381 missense possibly damaging 0.59
IGL01624:Usp17lb APN 7 104842513 utr 5 prime probably benign
IGL02582:Usp17lb APN 7 104840730 missense probably damaging 1.00
IGL03193:Usp17lb APN 7 104841277 missense possibly damaging 0.46
R0399:Usp17lb UTSW 7 104841151 missense possibly damaging 0.81
R0420:Usp17lb UTSW 7 104840539 missense probably benign
R1202:Usp17lb UTSW 7 104842488 missense probably damaging 0.98
R1628:Usp17lb UTSW 7 104840841 missense probably damaging 1.00
R2085:Usp17lb UTSW 7 104840415 missense possibly damaging 0.73
R2214:Usp17lb UTSW 7 104841432 missense probably benign 0.36
R2283:Usp17lb UTSW 7 104840652 missense possibly damaging 0.68
R2866:Usp17lb UTSW 7 104840748 missense probably damaging 1.00
R3433:Usp17lb UTSW 7 104841648 missense possibly damaging 0.89
R5004:Usp17lb UTSW 7 104841677 missense probably benign 0.00
R5090:Usp17lb UTSW 7 104841083 missense probably benign 0.06
R5143:Usp17lb UTSW 7 104841478 missense probably damaging 1.00
R5366:Usp17lb UTSW 7 104840408 missense possibly damaging 0.95
R5568:Usp17lb UTSW 7 104841208 missense probably damaging 1.00
R5647:Usp17lb UTSW 7 104840674 missense possibly damaging 0.92
R5981:Usp17lb UTSW 7 104841187 missense probably damaging 1.00
R5999:Usp17lb UTSW 7 104840345 missense probably damaging 0.99
R6114:Usp17lb UTSW 7 104840364 missense possibly damaging 0.87
R6185:Usp17lb UTSW 7 104841424 missense probably benign 0.22
R6279:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6300:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6891:Usp17lb UTSW 7 104841100 missense probably benign 0.02
R7000:Usp17lb UTSW 7 104841285 missense probably damaging 1.00
R7137:Usp17lb UTSW 7 104841591 missense probably benign 0.15
R7318:Usp17lb UTSW 7 104841133 missense probably benign 0.03
R7372:Usp17lb UTSW 7 104841706 splice site probably null
R7809:Usp17lb UTSW 7 104841213 missense probably damaging 1.00
R7834:Usp17lb UTSW 7 104841511 missense probably damaging 1.00
R8008:Usp17lb UTSW 7 104841274 missense possibly damaging 0.82
R8283:Usp17lb UTSW 7 104840806 missense probably damaging 0.98
R8385:Usp17lb UTSW 7 104840623 missense possibly damaging 0.82
X0021:Usp17lb UTSW 7 104841316 missense probably damaging 1.00
Z1088:Usp17lb UTSW 7 104841129 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTATTCCTGAGGTTCTGCCC -3'
(R):5'- GTGCAACTTGTCACAGTGGAC -3'

Sequencing Primer
(F):5'- CTGTTCCTGAGGCGTGAG -3'
(R):5'- GTGCAACTTGTCACAGTGGACATTAC -3'
Posted On2016-10-26