Incidental Mutation 'R5605:Mrvi1'
ID439247
Institutional Source Beutler Lab
Gene Symbol Mrvi1
Ensembl Gene ENSMUSG00000005611
Gene NameMRV integration site 1
SynonymsRis1
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110868266-110982461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110946002 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 29 (C29Y)
Ref Sequence ENSEMBL: ENSMUSP00000114578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005751] [ENSMUST00000125758] [ENSMUST00000154466]
Predicted Effect probably benign
Transcript: ENSMUST00000005751
SMART Domains Protein: ENSMUSP00000005751
Gene: ENSMUSG00000005611

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
low complexity region 138 160 N/A INTRINSIC
Pfam:MRVI1 265 856 1.8e-227 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125758
AA Change: C29Y

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114578
Gene: ENSMUSG00000005611
AA Change: C29Y

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
Pfam:MRVI1 336 921 1.5e-202 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142368
Predicted Effect probably benign
Transcript: ENSMUST00000154466
SMART Domains Protein: ENSMUSP00000120765
Gene: ENSMUSG00000005611

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene is a putative tumor suppressor gene that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein participates in signaling by nitric oxide (NO) to inhibit intracellular calcium release and platelet aggregation in cardiovascular tissue. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show lower blood pressure, a slightly reduced heart rate, and failure of cGMP-mediated relaxation of receptor-triggered smooth muscle contraction; 50% of mice die prematurely with an enlarged stomach, a dilated cecum, pyloric stenosis and impaired GI motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Mrvi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Mrvi1 APN 7 110945967 missense possibly damaging 0.64
IGL01384:Mrvi1 APN 7 110926501 missense possibly damaging 0.89
IGL01474:Mrvi1 APN 7 110871433 missense possibly damaging 0.65
IGL02081:Mrvi1 APN 7 110924074 critical splice acceptor site probably null
IGL02193:Mrvi1 APN 7 110898955 missense probably damaging 1.00
IGL02537:Mrvi1 APN 7 110871473 nonsense probably null
IGL03084:Mrvi1 APN 7 110885829 splice site probably benign
IGL03264:Mrvi1 APN 7 110926346 missense probably benign 0.00
hurricane UTSW 7 110923963 missense probably benign 0.09
R0346:Mrvi1 UTSW 7 110898976 missense probably damaging 1.00
R0401:Mrvi1 UTSW 7 110876897 missense probably benign 0.09
R0731:Mrvi1 UTSW 7 110876900 missense probably benign 0.00
R1168:Mrvi1 UTSW 7 110895931 missense probably damaging 1.00
R1342:Mrvi1 UTSW 7 110888045 missense probably benign 0.07
R1887:Mrvi1 UTSW 7 110924533 critical splice donor site probably null
R2183:Mrvi1 UTSW 7 110898982 missense probably damaging 1.00
R3417:Mrvi1 UTSW 7 110876954 missense possibly damaging 0.90
R3736:Mrvi1 UTSW 7 110923963 missense probably benign 0.09
R4063:Mrvi1 UTSW 7 110923777 missense probably benign 0.38
R4436:Mrvi1 UTSW 7 110876917 missense probably damaging 1.00
R4523:Mrvi1 UTSW 7 110923841 missense probably benign 0.02
R4948:Mrvi1 UTSW 7 110888029 missense probably damaging 1.00
R5070:Mrvi1 UTSW 7 110925312 missense probably benign
R5085:Mrvi1 UTSW 7 110871493 missense probably damaging 1.00
R6194:Mrvi1 UTSW 7 110899694 missense probably damaging 1.00
R6218:Mrvi1 UTSW 7 110876905 missense probably benign 0.00
R6273:Mrvi1 UTSW 7 110871583 missense probably benign 0.01
R6608:Mrvi1 UTSW 7 110888551 missense probably damaging 1.00
R6754:Mrvi1 UTSW 7 110929512 missense probably damaging 1.00
R6835:Mrvi1 UTSW 7 110921334 missense probably damaging 1.00
R7064:Mrvi1 UTSW 7 110895854 missense probably damaging 1.00
R7304:Mrvi1 UTSW 7 110899724 missense possibly damaging 0.77
R7412:Mrvi1 UTSW 7 110923756 missense probably benign 0.06
R7420:Mrvi1 UTSW 7 110871473 nonsense probably null
R7857:Mrvi1 UTSW 7 110923535 nonsense probably null
R8078:Mrvi1 UTSW 7 110899735 missense probably damaging 1.00
R8139:Mrvi1 UTSW 7 110899672 critical splice donor site probably null
R8280:Mrvi1 UTSW 7 110923621 missense possibly damaging 0.82
R8733:Mrvi1 UTSW 7 110878218 missense probably benign 0.02
X0065:Mrvi1 UTSW 7 110924044 missense probably benign 0.31
Z1176:Mrvi1 UTSW 7 110923999 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATGCTTAGTTTGGCCCC -3'
(R):5'- GTCACCTCTGCCCATGTAAAC -3'

Sequencing Primer
(F):5'- AAGGGGCACTTACTTGGGTC -3'
(R):5'- TCTGCCCATGTAAACAAAGCCAG -3'
Posted On2016-10-26