Incidental Mutation 'R5605:Sept1'
ID439248
Institutional Source Beutler Lab
Gene Symbol Sept1
Ensembl Gene ENSMUSG00000000486
Gene Nameseptin 1
SynonymsPNUTL3, Diff6
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127214447-127233130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127215426 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 260 (D260N)
Ref Sequence ENSEMBL: ENSMUSP00000101921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032910] [ENSMUST00000106313] [ENSMUST00000106314] [ENSMUST00000127710] [ENSMUST00000133913] [ENSMUST00000142356] [ENSMUST00000152267] [ENSMUST00000206772] [ENSMUST00000206204]
Predicted Effect probably benign
Transcript: ENSMUST00000032910
SMART Domains Protein: ENSMUSP00000032910
Gene: ENSMUSG00000030672

DomainStartEndE-ValueType
EFh 29 57 9.77e-5 SMART
EFh 99 127 4.45e1 SMART
Blast:EFh 135 163 2e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106313
AA Change: D232N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101920
Gene: ENSMUSG00000000486
AA Change: D232N

DomainStartEndE-ValueType
Pfam:DUF258 1 74 4.2e-8 PFAM
Pfam:MMR_HSR1 1 200 5.7e-8 PFAM
Pfam:Septin 1 274 5.7e-120 PFAM
coiled coil region 297 336 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106314
AA Change: D260N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101921
Gene: ENSMUSG00000000486
AA Change: D260N

DomainStartEndE-ValueType
Pfam:Septin 22 302 3.9e-124 PFAM
Pfam:MMR_HSR1 27 171 6.2e-9 PFAM
low complexity region 349 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127710
SMART Domains Protein: ENSMUSP00000120915
Gene: ENSMUSG00000030672

DomainStartEndE-ValueType
Pfam:EF-hand_8 7 34 9.7e-3 PFAM
Pfam:EF-hand_1 9 37 1.6e-6 PFAM
Pfam:EF-hand_6 9 38 1.6e-6 PFAM
Pfam:EF-hand_8 21 54 5.1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133733
Predicted Effect probably benign
Transcript: ENSMUST00000133913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139613
Predicted Effect probably benign
Transcript: ENSMUST00000142356
SMART Domains Protein: ENSMUSP00000114468
Gene: ENSMUSG00000000486

DomainStartEndE-ValueType
Pfam:DUF258 1 74 1.4e-8 PFAM
Pfam:MMR_HSR1 1 172 1.4e-8 PFAM
Pfam:Septin 1 186 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143222
Predicted Effect possibly damaging
Transcript: ENSMUST00000152267
AA Change: D226N

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206772
Predicted Effect probably benign
Transcript: ENSMUST00000206204
Meta Mutation Damage Score 0.4042 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Sept1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0675:Sept1 UTSW 7 127216999 missense probably damaging 0.99
R1375:Sept1 UTSW 7 127218161 missense probably damaging 1.00
R1627:Sept1 UTSW 7 127218058 critical splice acceptor site probably null
R1886:Sept1 UTSW 7 127214765 unclassified probably benign
R2409:Sept1 UTSW 7 127215971 critical splice acceptor site probably null
R3872:Sept1 UTSW 7 127215275 unclassified probably benign
R4320:Sept1 UTSW 7 127217028 missense probably damaging 1.00
R4321:Sept1 UTSW 7 127217028 missense probably damaging 1.00
R4323:Sept1 UTSW 7 127217028 missense probably damaging 1.00
R4864:Sept1 UTSW 7 127216892 unclassified probably benign
R6838:Sept1 UTSW 7 127216722 missense probably benign 0.01
R6870:Sept1 UTSW 7 127217704 missense probably benign 0.25
R7030:Sept1 UTSW 7 127216985 missense probably benign 0.12
R7494:Sept1 UTSW 7 127214950 missense probably damaging 0.98
R7797:Sept1 UTSW 7 127214765 missense unknown
R8002:Sept1 UTSW 7 127215902 missense probably damaging 1.00
X0021:Sept1 UTSW 7 127215353 missense possibly damaging 0.94
Z1177:Sept1 UTSW 7 127215963 missense possibly damaging 0.93
Z1177:Sept1 UTSW 7 127216902 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAGGAAGGCTTGCCCAAAC -3'
(R):5'- GTTCGGTCTGAATTCATACGTGAAG -3'

Sequencing Primer
(F):5'- GGCGCCATGGAAGCACC -3'
(R):5'- CTGAATTCATACGTGAAGTTGGAG -3'
Posted On2016-10-26