Incidental Mutation 'R5605:Rbm34'
ID439250
Institutional Source Beutler Lab
Gene Symbol Rbm34
Ensembl Gene ENSMUSG00000033931
Gene NameRNA binding motif protein 34
Synonyms4930547K05Rik, D8Ertd233e
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location126947172-126971071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126949419 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 382 (K382R)
Ref Sequence ENSEMBL: ENSMUSP00000048450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045994] [ENSMUST00000179857] [ENSMUST00000212618] [ENSMUST00000212771]
Predicted Effect probably benign
Transcript: ENSMUST00000045994
AA Change: K382R

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048450
Gene: ENSMUSG00000033931
AA Change: K382R

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 140 152 N/A INTRINSIC
RRM 190 280 5.33e-10 SMART
RRM 292 364 5.2e-22 SMART
internal_repeat_2 394 404 6.88e-5 PROSPERO
internal_repeat_2 401 411 6.88e-5 PROSPERO
low complexity region 423 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083703
Predicted Effect probably benign
Transcript: ENSMUST00000179857
SMART Domains Protein: ENSMUSP00000136493
Gene: ENSMUSG00000093904

DomainStartEndE-ValueType
Pfam:MAS20 10 124 3.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212618
AA Change: K362R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000212771
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA-binding motif family of RNA recognition motif proteins. The encoded protein contains an RNA-binding domain made up of two RNA recognition motif subdomains referred to as RNA recognition motif-1 and RNA recognition motif-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Rbm34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Rbm34 APN 8 126969986 missense probably benign 0.10
IGL02505:Rbm34 APN 8 126949321 missense probably benign 0.08
IGL03166:Rbm34 APN 8 126970856 missense probably damaging 1.00
R0081:Rbm34 UTSW 8 126949484 missense probably damaging 0.99
R1186:Rbm34 UTSW 8 126965447 nonsense probably null
R1257:Rbm34 UTSW 8 126970893 missense possibly damaging 0.45
R1867:Rbm34 UTSW 8 126970881 missense probably benign 0.17
R1868:Rbm34 UTSW 8 126970881 missense probably benign 0.17
R4008:Rbm34 UTSW 8 126949287 missense probably benign 0.00
R4395:Rbm34 UTSW 8 126949381 missense probably benign 0.03
R4823:Rbm34 UTSW 8 126970905 missense probably benign 0.01
R4903:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R4964:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R4966:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R5734:Rbm34 UTSW 8 126970130 critical splice acceptor site probably null
R6515:Rbm34 UTSW 8 126961932 missense possibly damaging 0.48
R8263:Rbm34 UTSW 8 126965389 missense probably benign 0.03
R8544:Rbm34 UTSW 8 126970071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCAACCTCAGTTATTACTGC -3'
(R):5'- AGACCACTGAATTCTGACCTAC -3'

Sequencing Primer
(F):5'- ATTACTGCTGTTTTCTTGGTTTCTTC -3'
(R):5'- GACCACTGAATTCTGACCTACTAGTC -3'
Posted On2016-10-26