Incidental Mutation 'R5605:Tpm1'
ID439251
Institutional Source Beutler Lab
Gene Symbol Tpm1
Ensembl Gene ENSMUSG00000032366
Gene Nametropomyosin 1, alpha
SynonymsTM2, Tpm-1, alpha-TM, Tm3
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67022590-67049406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67049035 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 33 (E33G)
Ref Sequence ENSEMBL: ENSMUSP00000138784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030185] [ENSMUST00000034928] [ENSMUST00000050905] [ENSMUST00000113685] [ENSMUST00000113687] [ENSMUST00000113693] [ENSMUST00000113697] [ENSMUST00000113701] [ENSMUST00000113705] [ENSMUST00000113707] [ENSMUST00000129733]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030185
AA Change: E33G

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030185
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.7e-39 PFAM
Pfam:Tropomyosin 48 284 1.7e-102 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000034928
AA Change: E33G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034928
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:Tropomyosin_1 56 195 4.1e-29 PFAM
Pfam:Tropomyosin 90 326 5.9e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050905
AA Change: E33G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051888
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 5.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113685
AA Change: E33G

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109315
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 3.1e-102 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113687
AA Change: E33G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109317
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.4e-40 PFAM
Pfam:Tropomyosin 48 264 1.8e-92 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113693
AA Change: E33G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109323
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.1e-37 PFAM
Pfam:Tropomyosin 48 280 8.6e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113697
AA Change: E33G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109327
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113701
AA Change: E33G

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109331
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 1.6e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113705
AA Change: E33G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109335
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 9.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113707
AA Change: E33G

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109337
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129466
Predicted Effect probably damaging
Transcript: ENSMUST00000129733
AA Change: E33G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138784
Gene: ENSMUSG00000032366
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 4e-36 PFAM
Pfam:Tropomyosin 48 128 7.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131279
Meta Mutation Damage Score 0.4986 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Tpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01288:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01569:Tpm1 APN 9 67031108 splice site probably null
R1137:Tpm1 UTSW 9 67031118 splice site probably null
R1554:Tpm1 UTSW 9 67023429 missense probably benign 0.04
R2012:Tpm1 UTSW 9 67033965 nonsense probably null
R2898:Tpm1 UTSW 9 67031040 missense probably damaging 1.00
R3723:Tpm1 UTSW 9 67031945 intron probably benign
R3724:Tpm1 UTSW 9 67031945 intron probably benign
R4172:Tpm1 UTSW 9 67023367 missense probably benign 0.34
R4427:Tpm1 UTSW 9 67032565 intron probably benign
R4934:Tpm1 UTSW 9 67028049 splice site probably null
R5726:Tpm1 UTSW 9 67023412 missense probably damaging 0.97
R6556:Tpm1 UTSW 9 67028169 critical splice acceptor site probably null
R6910:Tpm1 UTSW 9 67031974 missense probably damaging 1.00
R7242:Tpm1 UTSW 9 67028101 missense probably benign
R7386:Tpm1 UTSW 9 67028167 missense probably benign
R8463:Tpm1 UTSW 9 67048230 missense probably benign 0.01
R8755:Tpm1 UTSW 9 67028089 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATCAGTCTAACTCTCGCGC -3'
(R):5'- TTGGCTGTCCTAAGGAATGCG -3'

Sequencing Primer
(F):5'- ATCAGTCTAACTCTCGCGCTTCTC -3'
(R):5'- CCCCTGGGAAAGTACATATCAGG -3'
Posted On2016-10-26