Incidental Mutation 'R5605:Tinag'
ID439252
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Nametubulointerstitial nephritis antigen
SynonymsTIN-ag
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76951693-77045794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77045412 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 97 (Y97H)
Ref Sequence ENSEMBL: ENSMUSP00000139155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
Predicted Effect probably damaging
Transcript: ENSMUST00000034911
AA Change: Y97H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: Y97H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184488
Predicted Effect probably damaging
Transcript: ENSMUST00000184897
AA Change: Y97H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357
AA Change: Y97H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Meta Mutation Damage Score 0.8389 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Ylpm1 G A 12: 85,028,853 R326H probably damaging Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 77045576 missense possibly damaging 0.93
IGL01524:Tinag APN 9 77045538 missense probably damaging 1.00
IGL01537:Tinag APN 9 77045603 missense probably benign 0.01
IGL01832:Tinag APN 9 77031756 missense probably benign 0.18
IGL02512:Tinag APN 9 77031787 splice site probably benign
IGL02888:Tinag APN 9 77031713 missense probably benign 0.24
R0179:Tinag UTSW 9 76996882 splice site probably benign
R0200:Tinag UTSW 9 76951935 missense probably damaging 1.00
R0206:Tinag UTSW 9 76999852 missense probably damaging 1.00
R0545:Tinag UTSW 9 77031710 missense possibly damaging 0.61
R0666:Tinag UTSW 9 77005687 missense probably benign 0.02
R0685:Tinag UTSW 9 76952003 missense probably damaging 1.00
R0732:Tinag UTSW 9 77001654 missense possibly damaging 0.93
R1445:Tinag UTSW 9 77045516 missense probably damaging 1.00
R2318:Tinag UTSW 9 77045411 missense probably damaging 1.00
R3809:Tinag UTSW 9 76951905 missense probably benign 0.15
R4747:Tinag UTSW 9 76996956 missense probably benign
R4781:Tinag UTSW 9 76996950 missense possibly damaging 0.69
R5110:Tinag UTSW 9 76952007 missense probably damaging 1.00
R5328:Tinag UTSW 9 77005631 nonsense probably null
R5897:Tinag UTSW 9 77045444 missense probably damaging 1.00
R6296:Tinag UTSW 9 76996935 missense possibly damaging 0.67
R6822:Tinag UTSW 9 77031702 missense probably benign 0.00
R6915:Tinag UTSW 9 77001615 missense probably damaging 1.00
R7285:Tinag UTSW 9 77045661 missense probably benign
R7334:Tinag UTSW 9 77001649 missense probably damaging 1.00
Z1177:Tinag UTSW 9 77045498 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCTAATACTATGGGTGAGCAGG -3'
(R):5'- AGGGCCAAGATTCACTAGAAATCAC -3'

Sequencing Primer
(F):5'- CTAATACTATGGGTGAGCAGGTGGAG -3'
(R):5'- ACACCATTTTTGAAGGTTCTCGG -3'
Posted On2016-10-26