Incidental Mutation 'R5605:Ylpm1'
ID439259
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
MMRRC Submission 043270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5605 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85028853 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 326 (R326H)
Ref Sequence ENSEMBL: ENSMUSP00000126347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect probably damaging
Transcript: ENSMUST00000021670
AA Change: R784H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: R784H

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101202
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164558
AA Change: R326H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244
AA Change: R326H

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168977
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Meta Mutation Damage Score 0.1019 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 C A 18: 67,442,355 G83* probably null Het
Arap2 A T 5: 62,615,067 M1476K possibly damaging Het
Catsper2 G A 2: 121,397,052 R546C possibly damaging Het
Ccdc109b T C 3: 129,917,009 E258G probably damaging Het
Ceacam5 T C 7: 17,747,236 F303L probably benign Het
Clvs1 A G 4: 9,281,751 D65G probably damaging Het
Coq5 T C 5: 115,283,717 probably null Het
D630045J12Rik A T 6: 38,191,764 V950E probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah7c A G 1: 46,798,235 D3936G possibly damaging Het
Doc2b T C 11: 75,771,960 E404G probably damaging Het
Dsg1b C T 18: 20,399,539 P547S probably benign Het
Erich6 A G 3: 58,625,119 Y356H probably damaging Het
Galnt6 C T 15: 100,697,225 R465Q probably damaging Het
Gbp5 T C 3: 142,501,276 S69P probably damaging Het
Gdpd4 T C 7: 98,006,300 V562A probably benign Het
Gm2075 T A 12: 88,011,998 C51S probably damaging Het
Gm340 T A 19: 41,582,863 I165N probably damaging Het
Greb1 A T 12: 16,708,726 V663D probably damaging Het
Gtf3c3 A T 1: 54,415,926 S593T probably benign Het
H2-Eb1 T C 17: 34,309,833 S113P probably benign Het
Herc3 C T 6: 58,857,727 R240C probably damaging Het
Iqub T C 6: 24,505,621 D96G probably benign Het
Kcnt2 A T 1: 140,574,743 E858D possibly damaging Het
Lrp2 C T 2: 69,523,299 R539K probably damaging Het
Lrrc10 C A 10: 117,045,900 P160T probably damaging Het
Map3k12 G T 15: 102,503,865 D280E probably benign Het
Mdn1 T C 4: 32,765,664 S5208P probably benign Het
Med20 C A 17: 47,623,144 probably benign Het
Mertk T C 2: 128,738,307 V227A probably benign Het
Mrvi1 C T 7: 110,946,002 C29Y possibly damaging Het
Ncstn A G 1: 172,081,150 probably benign Het
Nedd4l T C 18: 65,174,244 probably null Het
Nfyc A G 4: 120,790,489 probably benign Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nt5dc1 C T 10: 34,403,695 C117Y probably benign Het
Nup88 A T 11: 70,944,070 probably benign Het
Olfr5 C T 7: 6,480,326 V277M probably benign Het
Pbrm1 T A 14: 31,035,992 I193K probably benign Het
Pcsk2 T C 2: 143,749,245 probably benign Het
Pdzd2 A T 15: 12,592,350 C69* probably null Het
Polr1e A G 4: 45,018,723 T18A probably benign Het
Prima1 T A 12: 103,199,904 I124F probably benign Het
Rbm34 T C 8: 126,949,419 K382R probably benign Het
Rftn1 T G 17: 50,047,407 N309T probably damaging Het
Sept1 C T 7: 127,215,426 D260N probably damaging Het
Serpina3g T C 12: 104,241,040 V154A probably damaging Het
Spef2 A T 15: 9,609,520 N1306K probably damaging Het
Stk4 T C 2: 164,079,566 F29S probably damaging Het
Stxbp5 A G 10: 9,769,746 probably benign Het
Tbl3 T C 17: 24,700,759 T774A probably benign Het
Tinag A G 9: 77,045,412 Y97H probably damaging Het
Tpm1 T C 9: 67,049,035 E33G probably damaging Het
Usp17lb T C 7: 104,840,640 E359G probably benign Het
Vmn2r91 A G 17: 18,136,501 E810G probably damaging Het
Vwce A T 19: 10,658,038 T633S possibly damaging Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7514:Ylpm1 UTSW 12 85030494 missense possibly damaging 0.94
R7577:Ylpm1 UTSW 12 84997220 missense unknown
R7709:Ylpm1 UTSW 12 85013025 missense unknown
R7718:Ylpm1 UTSW 12 85029122 missense probably damaging 0.99
R7736:Ylpm1 UTSW 12 85012983 missense unknown
R7758:Ylpm1 UTSW 12 85015022 missense unknown
R7807:Ylpm1 UTSW 12 85014081 nonsense probably null
R7838:Ylpm1 UTSW 12 85048866 missense possibly damaging 0.90
R7846:Ylpm1 UTSW 12 85057268 missense probably damaging 0.98
R8170:Ylpm1 UTSW 12 85034027 missense probably benign 0.40
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Z1176:Ylpm1 UTSW 12 85030284 missense possibly damaging 0.93
Z1177:Ylpm1 UTSW 12 85057283 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAAGCACTGCTGCCTTAAC -3'
(R):5'- TCCAACAGTTGCTTTGGGG -3'

Sequencing Primer
(F):5'- ACATGGGATTTGCTAATGACCG -3'
(R):5'- GGGCCTTTCCACTGTGGTC -3'
Posted On2016-10-26